Question

Suppose you want to sequence the following DNA segment: 5’-GATCTCTTGAAATG-primer site-3’ You clone the fragment into...

Suppose you want to sequence the following DNA segment:

5’-GATCTCTTGAAATG-primer site-3’

You clone the fragment into a plasmid, transform it into bacterial cells and isolate DNA from one of the bacterial colonies. You use the Sanger sequencing method to determine the sequence, separating the products from the sequencing reactions by gel electrophoresis. Draw the bands that should appear on the gel from the four sequencing reactions.

0 0
Add a comment Improve this question Transcribed image text
Answer #1

Given that the primer site is at the 3' end of the DNA to be sequenced, the primer used for sequencing would be a reverse primer that would anneal to the 3' end of the 5' > 3' template strand and the sequence would be that of the 3' > 5' (complementary) strand. Hence the sequence would be:

5'- primer- CATTTCAAGAGATC -3'

In sanger sequencing, the concentration of dideoxy nucleotides is more in the initial stages of the reaction and so the sequence would terminate forming smaller fragments at the beginning followed by longer fragments as the reaction progresses. Now, when the samples are electrophoresced, we get the smaller fragments at the bottom and the longer ones at the top so the sequence is read from the bottom of the gel.

Add a comment
Know the answer?
Add Answer to:
Suppose you want to sequence the following DNA segment: 5’-GATCTCTTGAAATG-primer site-3’ You clone the fragment into...
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Not the answer you're looking for? Ask your own homework help question. Our experts will answer your question WITHIN MINUTES for Free.
Similar Homework Help Questions
  • 3. A primer used in dideoxy DNA sequencing is 5’GGATCCATGACTAGTCCGAC-3’. A segment of DNA is cloned...

    3. A primer used in dideoxy DNA sequencing is 5’GGATCCATGACTAGTCCGAC-3’. A segment of DNA is cloned into a vector and then the vector DNA is denatured and subjected to dideoxy DNA sequencing method. Below is the DNA sequence from a region of the vector. 5’GGGCTAGCCGGATCCATGACTAGTCCGACTTACTGACCATCGACTCATCC-3’ 3-CCCGATCGGCCTAGGTACTGATCAGGCTGAATGACTGGTAGCTGAGTAGG-5’ To which DNA strand does the primer bind, the top or bottom one? Based on the sequence above, what would be the sizes of the bands (i.e., the number of nucleotides in each band)...

  • 3. (2 pts.) You are sequencing the end of a genomic DNA fragment that was cut...

    3. (2 pts.) You are sequencing the end of a genomic DNA fragment that was cut with the restriction enzyme BamH1 and ligated into a plasmid that was also cut with BamH1. You have denatured the DNA and annealed a labeled primer to plasmid sequences adjacent t<o the insertion site as shown below: 3' BamHi 5' GATCTAGCTAGCTAGCTAGCTAGCTAGCTAGCCATCGATGCTAGGAATCTTTGCTGATGCTAGTCGATGCCGTAGC ACTACGATCAGCTACGGC 3' 18 base primer 5' Next you add DNA polymerase, buffer, an excess of all four dNTPs, and a small amount of...

  • You are preparing to clone a DNA fragment into a plasmid vector. You start by linearizing...

    You are preparing to clone a DNA fragment into a plasmid vector. You start by linearizing your plasmid (concentration = 500 ng/μl) with EcoRI, which is provided in a standard 50% glycerol solution at 10 units/μl. Your enzyme also comes with an appropriate 10X reaction buffer.  Taking into account the final allowable glycerol concentration, you want to add the maximum amount of EcoRI, to achieve complete digestion of 1 μg plasmid DNA in a total volume of 20 μl. Fill...

  • Write true or false ______ 1. The DNA sequence of one human being is on average...

    Write true or false ______ 1. The DNA sequence of one human being is on average 99.9% identical to another random human being. ______ 2. As of 2009, all living human beings have had their entire genome sequenced. ______ 3. The nucleotide bases present in a DNA sequence are A, U, G, C. ______ 4. Techniques that enabled scientists to clone genes were developed in the 1970s. ______ 5. A restriction enzyme is useful because it is a generic enzyme...

  • Below is a set of experiments for cloning the human growth hormone (HGH) gene and then...

    Below is a set of experiments for cloning the human growth hormone (HGH) gene and then expressing the HGH protein in E. coli starting from human pituitary glands and a tube of plasmid vector DNA. The plasmid expression vector contains the arabinose inducible expression system. Specify the correct order for carrying out these experiments, using the letter codes in front of each procedure. Use all of the steps in your answer, except for one step that should NOT be included....

  • find three errors in the pragraph and reconstruct the gel DI Succuleluujective vi, a 16 points)...

    find three errors in the pragraph and reconstruct the gel DI Succuleluujective vi, a 16 points) PCR is a powerful tool used to isolate and make large quantities of a defined DNA fragment from a complex genome. PCR takes advantage of electrophoresis and synthetic oligonucleotides. Its starting material can be as small as a single cell. Because amplification is exponential, a single DNA molecule can be copied into hundreds of copies in a single day. Once a reference DNA sequence...

  • What solution is used to isolate the DNA from the bacterial cells 7. Alkaline lysis buffer...

    What solution is used to isolate the DNA from the bacterial cells 7. Alkaline lysis buffer b Acidic lysis buffer RNase C d None of the above 8 What solution is used to isolate the DNA from the spin column? DNA buffer a. b. Elution buffer P1 c. d. P2 9 EcoRI restriction site is 5' GAATTC 3' and 3' CTTAAG 5 a 5' GAATTC 3' and 3' CTTAAG 5 b 5' GAATTC 3' and 3' CTTAAG 5 C. d....

  • The PCR was a success and your target region of 770 bp in length has been...

    The PCR was a success and your target region of 770 bp in length has been amplified. You now plan to digest the DNA amplicon with the restriction enzyme Eael, and clone the resulting longest fragment it into the Eael site of the 5 kb plasmid diagrammed below. 770 bp BamHI 1 200 EcoRI 800 EcoRI 4000 1000 5 kb O /1000 2000 2000 Faal You purify your recombinant plasmid from bacterial cells, and run the plasmid (uncut. or not...

  • NEED HELP WITH THESE QUESTIONS. PLEASE ANSWER ALL AND EXPLAIN AS WELL. THANKSSSSSSS 1. You want...

    NEED HELP WITH THESE QUESTIONS. PLEASE ANSWER ALL AND EXPLAIN AS WELL. THANKSSSSSSS 1. You want to clone a gene from a donor vector to a host vector. List the correct order of events in the process of cloning a. Perform ligation reaction of cloned gene and host vector. b. Perform double digestion of both donor and host vectors with the 2 restriction enzymes c. Examine donor and host vectors for restriction sites d. Purify cloned gene from donor vector...

  • A1. The following is the DNA sequence of a hypothetical gene for the SMALL protein. It...

    A1. The following is the DNA sequence of a hypothetical gene for the SMALL protein. It is called the SMALL gene. i atgggattac actgtcacga ccaaatagcc ttcattgtat 41 caaaaggato aatcgagtta tag Imagine you are doing a research project in a laboratory and your supervisor asks you to clone the SMALL gene into the PBR322 plasmid (shown below). You must use the Pstl and EcoRI sites for your cloning. HindIII EcoRI | EcoRV BamHI 4359 0 29 185 4000 375 Sall Psti...

ADVERTISEMENT
Free Homework Help App
Download From Google Play
Scan Your Homework
to Get Instant Free Answers
Need Online Homework Help?
Ask a Question
Get Answers For Free
Most questions answered within 3 hours.
ADVERTISEMENT
ADVERTISEMENT
ADVERTISEMENT