Draw the structure of the phenylthiohydantoin product you would obtain by Edman degradation of these peptides. Show the configuration of the chirality center on the heterocycle.
a) H-Ile-Leu-Pro-Phe-OH
b) H-Asn-Thr-Ser-Gly-Ala-OH
Please answer both A and B
Draw the structure of the phenylthiohydantoin product you would obtain by Edman degradation of these peptides....
please explain how to solve this problem, the answer is provided 9. Peptides: (20 pts.). A polypeptide (X) gives 7 fragments when treated with chymotrypsin (A-G). The same peptide also gives 9 fragments when treated with trypsin (I- IX). After Chymotrypsin A) Thr-Thr-Tyr-Ala-Gly-Phe-Phe-Ile-Asp- Lys B) Ala-Cys-Pro-Leu-Tyr-Gin-lle-Arg C) Met-Ser-Thr-Tyr-Pro-Gly-Arg D) Cys-Leu-Val-Phe-Ile-Lys E) Leu-Ala-Trp-Gly-Val F) Ser-Phe-Ala-Pro-Lys G) Met-Asp-Lys Afier Trypsin I) Ala-Pro-Lys-Met-Asp-Lys-Thr-Thr-Tyr II) Pro-Gly-Arg-Cys-Leu-Val-Phe III) Ile-Lys-Ala-Cys-Pro-Leu-Tyr IV) Ile-Asp-Lys-Met-Ser-Thr-Tyr V) Gin-Ile-Arg-Leu-Ala-Trp VIAla-Gly-Phe VII) Gly-Val VIII) Ser-Phe LX) Phe A) What is the primary...
What two restriction enzymes could you use if you wanted to produce a protein that was fused to a GST-tag that could be removed using thrombin? Would this experimental design place any other tags on your protein? Here is the vector: T7 promoter lac operator Xbal rbs Ndel AATTAATACGACTCACTATAGGGGAATTGTGAGCGGATAACAATTCCCCTCTAGAAATAATTTTGTTTAACTTTAAGAAGGAGATATACATATGTCCCCT Met Ser Pro GST Ta His TagSacl ATACTAGGTTAT.627bp...GACCATCCTCCAAAATCGGATGGTTCAACTAGTGGTTCTGGTCATCACCATCACCATCACTCCGCGGGTCTGGTGCCACGCGGTAGT lle Leu Gly Tyr.. .209aa. . . Asp His Pro Pro Lys Ser Asp Gly Ser Thr Ser Gly Ser Gly His His...
What fragments will be obtained by a trypsin hydrolysis of the following octapeptide? Ala-Val-Trp-Lys-Phe-Gly-Arg-Met A) Ala-Val-Trp-Lys-Phe and Gly-Arg-Met 3) Ala-Val-Trp-Lys-Phe-Gly and Arg-Met - Ala-Val-Trp-Lys and Phe-Gly-Arg and Met ) Ala-Val-Trp-Lys and Phe and Gly-Arg and Met ) Ala-Val-Trp and Lys-Phe-Gly and Arg-Met Bradykinin is a nonapeptide, Arg-Pro-Pro-Gly-Phe-Ser-Pro-Phe-Arg. In addition to one mole of Arg, what peptides are present after hydrolysis of bradykinin with chymotrypsin? A) Arg-Pro-Pro and Gly-Phe and Ser-Pro-Phe B) Pro-Pro-Gly and Phe-Ser-Pro-Phe-Arg C) Arg-Pro-Pro-Gly-Phe and Ser-Pro-Phe ?) Arg-Pro-Pro-Gly-Phe-Ser...
Met-Ala-Arg-Tyr-Ala-Asn-Asn-Glu__Lys-Glu-Leu-Leu-Tyr__Arg-Tyr-Ala-Asn__Phe-Leu-Ala-Asn-Asn-Ile-Gly-Ala-Asn__Ile-Ser__Ile-Asn-Thr-Glu-Arg-Glu-Ser-Thr-Glu-Asp__Ile-Asn__ His-Glu-Arg__Phe-Ala-Thr-His-Glu-Arg-Ser__Thr-Arg-Ile-Gly-Leu-Tyr-Cys-Glu-Arg-Ile-Asp-Glu__Leu-Glu-Val-Glu-Leu-Ser__Ser-Ile-Asn-Cys-Glu__His-Glu-__His-Ala-Pro-Pro-Ile-Leu-Tyr__Glu-Ala-Thr-Ser__Val-Ala-Asn-Ile-Leu-Leu-Ala__Cys-Ala-Lys-Glu-__Ala-Asn-Asp__Pro-Glu-Cys-Ala-Asn__Pro-Ile-Glu__Trp-Ile-Thr-His__Phe-Arg-Ile-Glu-Asp__Cys-His-Glu-Glu-Ser-Glu-Cys-Ala-Lys-Glu__Ile-Cys-Glu__Cys-Arg-Glu-Ala-Met__Glu-Val-Glu-Arg-Tyr-Asp-Ala-Tyr__Ala-Asn-Asp__Ser-His-Glu__Ile-Ser__Asp-Glu-Val-Ala-Ser-Thr-Ala-Thr-Glu-Asp__Thr-His-Ala-Thr__Asp-Ile-Ser-Glu-Ala-Ser-Glu-Ser__Leu-Ile-Lys-Glu__His-Glu-Ala-Arg-Thr__Asp-Ile-Ser-Glu-Ala-Ser-Glu__Ser-Leu-Glu-Glu-Pro__Ala-Pro-Asn-Glu-Ala__Ser-Glu-Val-Glu-Arg-Glu__Trp-Glu-Ile-Gly-His-Thr__Gly-Ala-Ile-Asn__Trp-Ile-Leu-Leu__Ala-Arg-Ile-Ser-Glu__Ile-Phe__His-Glu__Lys-Glu-Glu-Pro-Ser__Thr-His-Ile-Ser__Glu-Ala-Thr-Ile-Asn-Gly__Pro-Ala-Thr-Thr-Glu-Arg-Asn__Tyr-Glu-Thr__Ile-Phe__His-Glu__Trp-Trp-Trp-Trp-Ile-Ile-Ile-Ile-Ile-Leu-Leu-Leu-Leu-Leu-Ser-Ser-Ser-Ser__Cys-His-Ala-Asn-Gly-Glu__Ile-Asn__His-Ile-Ser__Leu-Ile-Phe-Glu-Ser-Thr-Tyr-Leu-Glu__His-Glu__Cys-Ala-Asn__Ser-Thr-Ile-Leu-Leu__Arg-Glu-Met-Ala-Ile-Asn__His-Glu-Ala-Leu-Thr-His-Tyr__Ser-Ala-Ser-Ser-Tyr__Ala-Asn-Asp__Ala-Leu-Arg-IleGly-His-Thr 1.) Write out the 1 letter amino acid abbreviation for each of the three-letter amino acid abbreviated words listed in the given sequence. The __ indicates a space in between the words. Use www.expasy.org and other bioinformatic tools to generate the following bioinformatic data for the given polypeptide sequence. You must give the name and link to the program you used to generate the data: 2.) Compute the pI and Mw (isoelectric point and molecular mass, respectively) of...
i think there are two right answers? From the partial nucleotide sequence given below, what peptides could be encoded? 5-GCCUCCAAAccccucCA-3' Choose one or more: A. Ala-Ser-Lys-Pro-Leu B. Leu-Gln-Thr-Pro-Pro C. Pro-Pro-Asn-Pro-Ser D. Lys-Pro-Ser-Gly-Met E. Met-Arg-His-Asp-Pro From the partial nucleotide sequence given below, what peptides could be encoded? 5-GCCUCCAAAccccucCA-3' Choose one or more: A. Ala-Ser-Lys-Pro-Leu B. Leu-Gln-Thr-Pro-Pro C. Pro-Pro-Asn-Pro-Ser D. Lys-Pro-Ser-Gly-Met E. Met-Arg-His-Asp-Pro
. Insulin (below) is treated with dansyl chloride followed by its complete acidic hydrolysis. Which of the following dansylated amino acids you expect to observe? A chain Gly-Ile-Val-Glu-Gln-Cys-Cys- Ala-Ser-Val - Cys-Ser-Leu- Tyr-Gln-Leu-Glu-Asn - Tyr-Cys- Asn 10 15 21 B chain Phe-Val - Asn-Gln-His-Leu-Cys-Gly-Ser-His-Leu-Val-Glu - Ala-Leu-Tyr-Leu-Val-Cys-Gly-Glu-Arg-Gly-Phe-Phe-Tyr-Thr-Pro-Lys - Ala 10 20 25 30 15
PLEASE HELP OCHEM QUESTION 1. In the following protein, identify the type of bonding or interaction that is responsible for holding the two peptide chains together at each amino acid pair, above (A) and below (B). Gly - Ala - Ser - Cys - Val - Asp - Leu - Thr - His - Ile-Tyr-Glu - Phe - Lys - Cys - Met - Asn Val - Leu -Gin-Cys - Pro-Lys - Met - Tyr - Asp -Phe-Asn-Lys - Ile...
The next DNA sequence is the MATRICE strand of a small gene. What is the complete amino acid sequence of the encoded peptide? GTCATGGCAACATAG 5'-3 Standard Genetic Code First position (5'end) U Second position UAU Tyr UAC Tyr UCA Ser UAA StopUGA Stop UAG Stop UUU Phe UUC Phe UUA Leu UUG Leu UGU Cys UGC Cys UCU Ser UCC Ser UCG Ser UGG Trp CUU Leu CUC Leu CUA Leu CUG Leu CCU Pro CCC Pro CCA Pr CCG...
A small generic section of the primary structure of an α helix is given by −amino acid1−amino acid2−amino acid3−amino acid4−amino acid5−amino acid6−amino acid7− Which amino acid residue's backbone forms a hydrogen bond with the backbone of the third (3rd) residue? Which peptide segment is most likely to be part of a stable α helix at physiological pH ? −Glu−Leu−Ala−Lys−Phe− −Gly−Arg−Lys−His−Gly− −Gly−Gly−Gly−Ala−Gly− −Pro−Leu−Thr−Pro−Trp− −Lys−Lys−Ala−Arg−Ser− −Glu−Glu−Glu−Glu−Glu− −Tyr−Trp−Phe−Val−Ile−
20. This sequence is RNA because:A) it is single stranded.B) it contains U (uracil) and no T (thymine).C) it runs in a 5' to 3' direction.D) it codes for amino acids.E) it is a small molecule.21. Which amino acids does this sequence code for, if the reading frame is as shown, starting from the correct end? A) gly-ala-arg-cys-ile...B) pro-arg-ala-thr-stopC) met-asn-glu-leu...D) glu-leu-val-val-phe...E) leu-glu-gln-his-asn...22. If the sequence gets changed to 5' ... GGAGACUCGUUGUAUU... 3'. What would be the effect on the amino...