Given the following sequences for the bacterial promoter -10 region; TAGGACT TCGCAGA AAGCTTG TACCAAG TTCCTCG a....
Homework Answers
Add Answer to:
Given the following sequences for the bacterial promoter -10
region; TAGGACT TCGCAGA AAGCTTG TACCAAG TTCCTCG
a....
Look at the sequences in the figure. They all represent different bacterial promoter regions. Which of...
Look at the sequences in the figure. They all represent different bacterial promoter regions. Which of the sequences listed below is the best consensus sequence for the-35 region based on these seven promoters? -35 sequence -10 sequence loc operon TTTACAN, TATGIT NG loc! GCGCAA N CATGAT NYA trp operon TTGACA N TTAACT NyA τηX TTGTCT NE TAATAT N, A recA TTGATAN TATAAT NA lex TTCCAA NG TATACINE RNA ITTACANTATGATN TRNAV TITACA N, TATGAT N, А Multiple Choice o TTGCAA o...
How do the -10 and -35 consensus sequences in the bacteria promoter relate to evolution? A...
How do the -10 and -35 consensus sequences in the bacteria promoter relate to evolution? A mutation in the -10 (Pribnow) consensus sequence would have what affect?
4. A promoter for an E. coli gene that is transcribed by a s-70 RNA polymerase...
4. A promoter for an E. coli gene that is transcribed by a s-70 RNA polymerase has the following sequence: 30 -20 10 +1 5'GGCTTTACACTTTATGCTTCCGGCTCGTATGTTGTGTGGA 3'CCGAAATGTGAAATACGAAGGCCGAGCATACAACACACCT The transcription start site +1) is identified. a. Identify the -10 and -35 sequences. How close are they to the consensus-10 and-35 sequences? b. What is the spacing between the -10 and the -35 sequences? How does this compare with the consensus spacing? C. The sequence of bases in a transcribed RNA is identical...
Complete elimination of a bacterial gene's Shine-Delgarno sequence Complete elimination of a gene's promoter A single...
Complete elimination of a bacterial gene's Shine-Delgarno sequence Complete elimination of a gene's promoter A single base change in a bacterial gene's-35 TTGACA consensus sequence Complete elimination of the inverted repeat/hairpin loop structure and string • of uracils at the 3' untranslated region of a bacterial gene Complete elimination of the consensus sequence for 3 cleavage of a eukaryotic pre-mRNA Complete elimination of a splice site consensus sequence in a eukaryotic gene Abnormally long mRNA with the possibility of a...
Which of the following sequence is the right sequence for a bacterial gene? -35 consensus...transcription start...-10...
Which of the following sequence is the right sequence for a bacterial gene? -35 consensus...transcription start...-10 consensus...coding region...transcription termination transcription start...-35 consensus...coding region...-10 consensus...transcription termination transcription start...-35 consensus...-10 consensus...coding region...transcription termination -35 consensus...-10 consensus...transcription start....coding region...transcription termination
The constitutive promoter that you placed upstream of your gene is expressing too much of the...
The constitutive promoter that you placed upstream of your gene is expressing too much of the gene. Which of the following can you use to have it express less? ☐ Make the promoter weaker by changing the sequences of the -10 and -35 regions to their reverse complements ☐ Make the promoter stronger by changing the sequences of the -10 and -35 regions to more closely match the consensus sequences ☐ Make the promoter weaker by changing the sequences of...
Copy of Shown below is a plasmid containing several labeled sequences. Multi-cloning site (CS) Transcription terminator...
Copy of Shown below is a plasmid containing several labeled sequences. Multi-cloning site (CS) Transcription terminator Promoter TATA box original replication a) Based on the sequences it contains, is this plasmid intended for gene expression in eukaryotes or prokaryotes? How do you know? (3 pts) b) Based on your answer to part A, describe the promoter & terminator regions in a little more detail. What is a consensus sequence you would expect in the promoter? And what sorts of sequences...
There is a translation error in which a bacterial gene fails to initiate translation. What is...
There is a translation error in which a bacterial gene fails to initiate translation. What is one possible problem? A) There were problems in exporting the mRNA out of the nucleus B) There is a mutation at -10/-35 promoter consensus sequence. C) There is a mutation in the Shine-Delgarno sequence D) The 5' Cap is not added so the ribosome cannot find the start codon.
5. Here is another promoter region in E. coli. (Also in a larger format in the...
5. Here is another promoter region in E. coli. (Also in a larger format in the BlackBoard file) This one is between two genes. The gene whose start codon is underlined in red encodes an amino acid / proton symport. The gene whose start codon is underlined in blue encodes a protein used in glycolysis. The binding site for the CAP protein (with its cAMP cofactor) is indicated in green. SACASA & GAAS AAAAAAAAA AATTCCGTGTTGTATAATTT AĞCACAACATATTAAA CAP-CAMP AAAAAAAAAAAAAAAAAAAAAAAAA S L14...
4. Using the general rules for bacterial promoter parts discussed in class (and in your class...
4. Using the general rules for bacterial promoter parts discussed in class (and in your class notes), identify the -10, -35 and first transcribed nucleotide (+1 A) on the sense strand of the E coli promoter shown below. Briefly justify your rationale for selection of each sequence. E coli UreA promoter 5'-TTCTGTTAATCTTAGTAAATCAAAACATTGCTATAATTACATCCAACCTTGATTTCGTTAT-3' 5 In an attomnt to incroca violds of the protein aruthronolotin (EPO) you have changed the ribosoma hindi
Look at the sequences in the figure. They all represent different bacterial promoter regions. Which of the sequences listed below is the best consensus sequence for the-35 region based on these seven promoters? -35 sequence -10 sequence loc operon TTTACAN, TATGIT NG loc! GCGCAA N CATGAT NYA trp operon TTGACA N TTAACT NyA τηX TTGTCT NE TAATAT N, A recA TTGATAN TATAAT NA lex TTCCAA NG TATACINE RNA ITTACANTATGATN TRNAV TITACA N, TATGAT N, А Multiple Choice o TTGCAA o...
4. A promoter for an E. coli gene that is transcribed by a s-70 RNA polymerase has the following sequence: 30 -20 10 +1 5'GGCTTTACACTTTATGCTTCCGGCTCGTATGTTGTGTGGA 3'CCGAAATGTGAAATACGAAGGCCGAGCATACAACACACCT The transcription start site +1) is identified. a. Identify the -10 and -35 sequences. How close are they to the consensus-10 and-35 sequences? b. What is the spacing between the -10 and the -35 sequences? How does this compare with the consensus spacing? C. The sequence of bases in a transcribed RNA is identical...
Complete elimination of a bacterial gene's Shine-Delgarno sequence Complete elimination of a gene's promoter A single base change in a bacterial gene's-35 TTGACA consensus sequence Complete elimination of the inverted repeat/hairpin loop structure and string • of uracils at the 3' untranslated region of a bacterial gene Complete elimination of the consensus sequence for 3 cleavage of a eukaryotic pre-mRNA Complete elimination of a splice site consensus sequence in a eukaryotic gene Abnormally long mRNA with the possibility of a...
Copy of Shown below is a plasmid containing several labeled sequences. Multi-cloning site (CS) Transcription terminator Promoter TATA box original replication a) Based on the sequences it contains, is this plasmid intended for gene expression in eukaryotes or prokaryotes? How do you know? (3 pts) b) Based on your answer to part A, describe the promoter & terminator regions in a little more detail. What is a consensus sequence you would expect in the promoter? And what sorts of sequences...
5. Here is another promoter region in E. coli. (Also in a larger format in the BlackBoard file) This one is between two genes. The gene whose start codon is underlined in red encodes an amino acid / proton symport. The gene whose start codon is underlined in blue encodes a protein used in glycolysis. The binding site for the CAP protein (with its cAMP cofactor) is indicated in green. SACASA & GAAS AAAAAAAAA AATTCCGTGTTGTATAATTT AĞCACAACATATTAAA CAP-CAMP AAAAAAAAAAAAAAAAAAAAAAAAA S L14...
4. Using the general rules for bacterial promoter parts discussed in class (and in your class notes), identify the -10, -35 and first transcribed nucleotide (+1 A) on the sense strand of the E coli promoter shown below. Briefly justify your rationale for selection of each sequence. E coli UreA promoter 5'-TTCTGTTAATCTTAGTAAATCAAAACATTGCTATAATTACATCCAACCTTGATTTCGTTAT-3' 5 In an attomnt to incroca violds of the protein aruthronolotin (EPO) you have changed the ribosoma hindi
Most questions answered within 3 hours.
-
What is the net ionic equation for the reaction that would occur
when an aqueous solution...
asked 2 hours ago -
A
student bought $1000 worth of furniture. What is the equivalent
annual cost if it is...
asked 2 hours ago -
What taboo subject did Ida B. Wells suggest was consensual
between black men and white women?...
asked 3 hours ago -
You have just been hired by the EPA to help with the new gas
mileage standards...
asked 4 hours ago -
4) A firm is hit by increases in its wage rate, w.
a) How does this...
asked 4 hours ago -
A square current loop 5.4 cm on each side carries a 510 mA
current. The loop...
asked 7 hours ago -
What are five tips in conducting knowledge assessment/literature
review research? Each of these tips needs to...
asked 7 hours ago -
Antigen presenting cells link innate and adaptive immune
responses. In the theoretical scenario where phagosomes cannot...
asked 7 hours ago -
Dealing with conflict, in my opinion, is a skill and an art. I
believe that those...
asked 8 hours ago -
6. A long straight wire with circular cross section and radius
1.5 cm carries a 1.2...
asked 8 hours ago -
Deacon Corporation has provided the following financial data
from its balance sheet and income statement:
Year...
asked 9 hours ago -
List and discuss at least three variables from everyday life for
which you expect the variable ...
asked 9 hours ago