On what is attenuation based, which is common in operons (the Trp operon for example).
On what is attenuation based, which is common in operons (the Trp operon for example).
Homework Answers
Attenuation is based on presence of leader sequence located just upstream to the initial codon in tryptophan operon.
Attenuation help in regulation of switching on or off the operon.
Leader sequence contains 4 complementary region ( 1,2,3,4)
Region 1 contain two codon 10 and 11 code for tryptophan.
Pairing of complementary sequence present in leader sequence determine weather transcription takes place or not.
Sequence 1 and 2 pairing, 3 and 4 pairing- termination loop - no transcription , no tryptophan synthesize
Pairing of sequence 2 and 3 - antitermination loop- transcription occur
- in absence of tryptophan- ribosome stuck at codon 10 and 11 , due transcription sequence 2 and 3 came out. --- sequence 2 and 3 binds ---- formation of antitermination loop----- formation of tryptophan
------ excess tryptophan---- ribosome move rapidly---- reach to sequence 2 ,------ now 3 and 4 are free ------ binds form termination loop------ turn off of operon ----- no tryptophan synthesis.
Thus leader sequence and tryptophan both regulate this operon.
For better understanding, I have attached diagram below
Add Answer to:
On what is attenuation based, which is common
in operons (the Trp operon for
example).
Complete the comparison of the lac Operon and trp Operons as a means of gene regulation.
ACTIVITY #2: Operon control of gene expressionComplete the comparison of the lac Operon and trp Operons as a means of gene regulation. lac operorn trp operon Regulates production of Name of Regulatory gene" and what it produces What binds to the operator & when does this occur: Structural genes controlled by the operon and how their expression is controlled: High levels of what substance affects the operon how?
Trp Operon Examine the following trp operons. For each, explain whether you’d expect to see the...
Trp Operon Examine the following trp operons. For each, explain whether you’d expect to see the trp operon transcribed when: 1) Tryptophan level is high, translation is occurring 2) Tryptophan level is low, translation is NOT occurring G – Genome + = Present/functional P – Plasmid - = Absent/non-functional O – Operator L(#) – Leader sequence with region (#) mutated P – Promoter R – Repressor Rs – Repressor that is unable to bind tryptophan Operon 1 G: O+, L(none),...
What are some benefits and drawbacks to operons? What are the two components of a two-component...
What are some benefits and drawbacks to operons? What are the two components of a two-component regulatory system? Describe the localization of these proteins. What type of covalent modification is utilized in such systems? Attenuation and riboswitches are two methods of controlling gene expression at the level of transcription. Describe how the process of attenuation occurs in the trp Operon. How can riboswitches be described as a specialized type of attenuation? What would be the phenotype of an E. colistrain in which the...
Trp Operon 5. The rate of transcription of the trp operon in E. coli is controlled by both repression and attenuation dr papde ia) Alternate secondary structures formed by the trpl tranecript Alterna...
Trp Operon 5. The rate of transcription of the trp operon in E. coli is controlled by both repression and attenuation dr papde ia) Alternate secondary structures formed by the trpl tranecript Alternate 2 Regions 2 and 3 Atemate 1: Regions 1 and 2 basepared and regions 3 and 4 basepsired 54 140 Stop codon Transcribtion termination hairpin can NOT form a) Diagram and explain repression and attenuation regulatory mechanisms for the trp operon when tryptophan is present and absent....
Hello. At what step does attenuation regulate expression of the trp operon? a)transcript polyadenylation b)transcript capping...
Hello. At what step does attenuation regulate expression of the trp operon? a)transcript polyadenylation b)transcript capping c)transcript elongation d)transcript initation
Shown below is the trp mRNA leader. (A) How does attenuation in the trp operon work...
Shown below is the trp mRNA leader. (A) How does attenuation in the trp operon work to control the levels of Trpe peptide? What happens when tryptophan levels are high in the cell? When they are low? (drawings may be used to assist in your explanation)(B) Does this happen in eukaryotes, prokaryotes or both? Why? (6 pts) Leader peptide Met-Lys - Al-te-Phe Val- mRNA PPPAAGUUCACGUAAAAAGGGUAUCGACAAUGAAAGCAAUUUUCGUACUGA GUAGUA MARCGAAAUGCGUACCACUUAUGUGACGGGCAANGUCCUUCACGCGGUGGU stop)-Ser-Thr-Arg - Trp - Top- ACCCAGCCCGCCUAAUGAGCGGGCUUUUUUUUGAACAAAAUUAGAGAAUAAGAAUGCAAACA Met-Gin-The- Trpt polypeptide Site of transcription attenuation...
You are studying a mutant strain of bacteria in which the trp operon includes a mutation...
You are studying a mutant strain of bacteria in which the trp operon includes a mutation in region 1 of the 5'UTR. Whereas in the wildtype strain the affected codons code for "trp, in the mutant strain these codons code for "stop". How will this mutation affect attenuation? Translation of the S'UTR will stop at the position of the mutation in region 1. As a result, region 3 of the 5'UTR will pair with region 2 in the mRNA causing...
The trp and lac operons are regulated in various ways. How do bacteria regulate transcription of...
The trp and lac operons are regulated in various ways. How do bacteria regulate transcription of these operons? Sort the statements into the appropriate bins depending on whether or not each operon would be transcribed under the stated conditions.
Which of the following features of the trp operon is most essential to the process of...
Which of the following features of the trp operon is most essential to the process of attenuation independent of the repressor protein? The order of the structural genes, E, D, C, B, A Allosteric modifications as a result of tryptophan binding. The operator sequence (trpO) The ability of sequences within the leader mRNA to pair with one another and form stem-lopp structures
Expression of the trp operon is regulated by the level of free tryptophan in the cell...
Expression of the trp operon is regulated by the level
of free tryptophan in the cell both through repressor action and
attenuation. This chart shows the percent expression of the
trpoperon in the presence and absence of tryptophan for
wild-type (trpR+ or trp+) and repressor mutants
(trpR-).
Use this information to determine the levels of expression for the
following genotypes and conditions.
Rank the genotypes and conditions from highest to lowest level
of trp operon expression.
Please use information below...
Trp Operon 5. The rate of transcription of the trp operon in E. coli is controlled by both repression and attenuation dr papde ia) Alternate secondary structures formed by the trpl tranecript Alternate 2 Regions 2 and 3 Atemate 1: Regions 1 and 2 basepared and regions 3 and 4 basepsired 54 140 Stop codon Transcribtion termination hairpin can NOT form a) Diagram and explain repression and attenuation regulatory mechanisms for the trp operon when tryptophan is present and absent....
Shown below is the trp mRNA leader. (A) How does attenuation in the trp operon work to control the levels of Trpe peptide? What happens when tryptophan levels are high in the cell? When they are low? (drawings may be used to assist in your explanation)(B) Does this happen in eukaryotes, prokaryotes or both? Why? (6 pts) Leader peptide Met-Lys - Al-te-Phe Val- mRNA PPPAAGUUCACGUAAAAAGGGUAUCGACAAUGAAAGCAAUUUUCGUACUGA GUAGUA MARCGAAAUGCGUACCACUUAUGUGACGGGCAANGUCCUUCACGCGGUGGU stop)-Ser-Thr-Arg - Trp - Top- ACCCAGCCCGCCUAAUGAGCGGGCUUUUUUUUGAACAAAAUUAGAGAAUAAGAAUGCAAACA Met-Gin-The- Trpt polypeptide Site of transcription attenuation...
You are studying a mutant strain of bacteria in which the trp operon includes a mutation in region 1 of the 5'UTR. Whereas in the wildtype strain the affected codons code for "trp, in the mutant strain these codons code for "stop". How will this mutation affect attenuation? Translation of the S'UTR will stop at the position of the mutation in region 1. As a result, region 3 of the 5'UTR will pair with region 2 in the mRNA causing...
The trp and lac operons are regulated in various ways. How do bacteria regulate transcription of these operons? Sort the statements into the appropriate bins depending on whether or not each operon would be transcribed under the stated conditions.
Expression of the trp operon is regulated by the level
of free tryptophan in the cell both through repressor action and
attenuation. This chart shows the percent expression of the
trpoperon in the presence and absence of tryptophan for
wild-type (trpR+ or trp+) and repressor mutants
(trpR-).
Use this information to determine the levels of expression for the
following genotypes and conditions.
Rank the genotypes and conditions from highest to lowest level
of trp operon expression.
Please use information below...
Most questions answered within 3 hours.
-
PLEASE DO BOTH OF THESE IN PYTHON!!! AND MAKE SURE THAT
I CAN COPY THE CODE....
asked 27 seconds from now -
4. How could the Fed "finance the government's debt"? How does
that work, exactly?
5. In...
asked 2 minutes ago -
The x component of the velocity of an object vibrating
along the x-axis obeys the equation...
asked 1 hour ago -
A junction box contains two trade size 2 raceways on the left
side, and two trade...
asked 1 hour ago -
Atmospheric Mass
Venus and Earth have about the same mass and radius, but the
atmospheric pressure...
asked 2 hours ago -
5. Discuss the use of fault tree analysis (FTA) for risk
assessment (maximum one paragraph).
asked 3 hours ago -
Given that a sample of aluminium oxide has a Young's modulus of
393 GPa and a...
asked 4 hours ago -
At a certain temperature, the equilibrium constant, Kc, for this
reaction is 53.3.
H2(g)+I2(g)−⇀↽−2HI(g)Kc=53.3
At this...
asked 6 hours ago -
Question1 ) The STL provides similiar classes called stack and
queue, both of which gave functions...
asked 7 hours ago -
For Questions 1-4, assume you have 5 bits available:
1. For (positive) integers: What is the...
asked 7 hours ago -
convert grams into vloume with the density of water being at
.997514 g/cm^3 at 23.1 Celsuis...
asked 9 hours ago -
Foreman company obtained a $20,000, 6% loan on May 1, 2018.
Principal and interest will be...
asked 9 hours ago