Regarding the four bases in DNA, the double-stranded DNA molecule is held together by complementary bases....
Homework Answers
In the DNA molecule, guanine binds with Cytosin (always) and adenine binds with Thymine. In RNA, adenine binds with Uracil instead. Therefore, if the codon on the DNA strand is CAG, then the mRNA codon that will bind to it will be CAG.
hopen the answer helps.
Leave a thumbs up if u can.
Add Answer to:
Regarding the four bases in DNA, the double-stranded DNA
molecule is held together by complementary bases....
DNA is a double-stranded molecule where two polynucleotide strands run antiparallel to each other, and the...
DNA is a double-stranded molecule where two polynucleotide strands run antiparallel to each other, and the bases on one strand are complementary to the bases on the opposite strand. If one strand of a DNA molecule has the following sequence of bases, what would the sequence be for the complementary, antiparallel DNA strand? 3' GCTGATCAGGAC 5'
A segment of a double-stranded DNA molecule is shown below. The start of a gene is...
A segment of a double-stranded DNA molecule is shown below. The start of a gene is indicated as the +1 base pair: + 1 5'TATATTTTCTATATGCACATTTGCAAGTAA 3'(strand A) 3'ATATAAAAGATATACGTGTAAACGTTCATT 5'(strand B) Uparrow (A) If RNA polymerase moves along this DNA from left to right, indicate the position of the promoter region on this DNA and indicate which strand is the template strand (B) Write the complete mRNA that would be transcribed from the gene above, again being sure to label the...
Replicate the DNA strand below and create a complementary strand. Remember that complementary bases will always...
Replicate the DNA strand below and create a complementary strand. Remember that complementary bases will always match with each other Adenine--Thymine and Cytosine--Guanine. AGCCCGTCTTGGAAT
Please help with 4-10! DNA, Genes,and Protein Synthesis Activity 13: 2. The bases that interact with each other are called complementary bases. this definition and your answers to 1 complete th...
Please help with 4-10!
DNA, Genes,and Protein Synthesis Activity 13: 2. The bases that interact with each other are called complementary bases. this definition and your answers to 1 complete the following: a. Thiamine (T) is the complementary base of b. Cytosine (C) is the complementary base of c. Adenine (A) is the complementary base of d. Guanine (G) is the complementary base of Based on 3. Shown below is the nucleotide sequence for one strand of a stretch of...
Which of the following is true? a. The two strands of a DNA molecule are held...
Which of the following is true? a. The two strands of a DNA molecule are held together by covalent bonds. b. Hydrogen bonding between complementary base pairs causes the DNA molecule to twist into a spiral. c. A single strand within a DNA molecule is held together by hydrogen bonds. d. The bases on one strand of DNA are held to the bases on the other strand by hydrogen bonds.
DNA is formed by building blocks called __________. nucleotides nitrogenous bases polypeptides deoxyribose 0.5 points ...
DNA is formed by building blocks called __________. nucleotides nitrogenous bases polypeptides deoxyribose 0.5 points QUESTION 2 What does DNA stand for? Double-stranded Nucleic Acid Ribonucleic acid Deoxyribonucleic Acid Double-helix Nucleic Acid 0.5 points QUESTION 3 The nucleotides of DNA are held together by ___________. ionic bond hydrogen bond phosphodiester bond sugar-phosphate backbone 0.5 points QUESTION 4 DNA nucleotides with one-carbon nitrogen ring bases are called ________. adenines purines pyrimidines guanines 0.5 points QUESTION 5 Basic...
Use the words and phrases below to complete each sentence. (Not all words or phrases are...
Use the words and phrases below to complete each sentence. (Not all words or phrases are used.) removed from chromosomes double strand single strand 4210 unwound ribose with other RNA strands thymine within the same strand uracil adenine major and minor grooves 4 x 250 annealed histone complex 250" annealing with DNA guanine guanine Although only four different bases are present in DNA and RNA, the number of possible sequences in a 250-nucleotide chain is for proteins to copy the...
Fill in the complementary base pairs for the strand below STACGCCCATTI TAGA ATTGCGTGGGCATTAAGTTTTA TACC3 DNA sequences...
Fill in the complementary base pairs for the strand below STACGCCCATTI TAGA ATTGCGTGGGCATTAAGTTTTA TACC3 DNA sequences 3' I Find and put a square around the TATA box (promoter) in the double stranded DNA above Find and circle the terminator sequence (GGGCG) in one of the strands above The strand with promoter and terminator is the strand of interest: using the template strand, synthesize an mRNA sequence mRNA molecule in the boxes below; pay attention to polarity 53: Find and circle...
DNA, Genes and Protein Synthesis Activity 13: Protein Synthesis is the process by which cells produce (synthesize) proteins. An overview of the process is shown in model 2 (below). Gone 2...
DNA, Genes and Protein Synthesis Activity 13: Protein Synthesis is the process by which cells produce (synthesize) proteins. An overview of the process is shown in model 2 (below). Gone 2 Gene 1 Gene 3 DNA strand3 TRANSLATION Protein Trp Gly Model 2 ACTIVITY and QUESTIONS 1. Based on the information you can gather from model 1 complete the following sentences: a. The nucleotide Adenine (A) always pairs with the nucleotide b. The nucleotide Guanine (G) always pairs with the...
Unwinds DNA strand to make replication fork. Adds free nucleotides to the growing daughter DNA strands...
Unwinds DNA strand to make replication fork. Adds free nucleotides to the growing daughter DNA strands Adds short pieces of RNA to help DNA polymerase start Removes RNA and replaces with DNA Fuses or "glues" fragments of DNA together Proofreads or edits the DNA, checking for mistakes Given the following, DNA Sequence, what is the new daughter strand? (Did you label the 5' and 3' ends?) What is the name of the "fragments" of DNA on the lagging strand after...
A segment of a double-stranded DNA molecule is shown below. The start of a gene is indicated as the +1 base pair: + 1 5'TATATTTTCTATATGCACATTTGCAAGTAA 3'(strand A) 3'ATATAAAAGATATACGTGTAAACGTTCATT 5'(strand B) Uparrow (A) If RNA polymerase moves along this DNA from left to right, indicate the position of the promoter region on this DNA and indicate which strand is the template strand (B) Write the complete mRNA that would be transcribed from the gene above, again being sure to label the...
Please help with 4-10!
DNA, Genes,and Protein Synthesis Activity 13: 2. The bases that interact with each other are called complementary bases. this definition and your answers to 1 complete the following: a. Thiamine (T) is the complementary base of b. Cytosine (C) is the complementary base of c. Adenine (A) is the complementary base of d. Guanine (G) is the complementary base of Based on 3. Shown below is the nucleotide sequence for one strand of a stretch of...
Use the words and phrases below to complete each sentence. (Not all words or phrases are used.) removed from chromosomes double strand single strand 4210 unwound ribose with other RNA strands thymine within the same strand uracil adenine major and minor grooves 4 x 250 annealed histone complex 250" annealing with DNA guanine guanine Although only four different bases are present in DNA and RNA, the number of possible sequences in a 250-nucleotide chain is for proteins to copy the...
Fill in the complementary base pairs for the strand below STACGCCCATTI TAGA ATTGCGTGGGCATTAAGTTTTA TACC3 DNA sequences 3' I Find and put a square around the TATA box (promoter) in the double stranded DNA above Find and circle the terminator sequence (GGGCG) in one of the strands above The strand with promoter and terminator is the strand of interest: using the template strand, synthesize an mRNA sequence mRNA molecule in the boxes below; pay attention to polarity 53: Find and circle...
DNA, Genes and Protein Synthesis Activity 13: Protein Synthesis is the process by which cells produce (synthesize) proteins. An overview of the process is shown in model 2 (below). Gone 2 Gene 1 Gene 3 DNA strand3 TRANSLATION Protein Trp Gly Model 2 ACTIVITY and QUESTIONS 1. Based on the information you can gather from model 1 complete the following sentences: a. The nucleotide Adenine (A) always pairs with the nucleotide b. The nucleotide Guanine (G) always pairs with the...
Unwinds DNA strand to make replication fork. Adds free nucleotides to the growing daughter DNA strands Adds short pieces of RNA to help DNA polymerase start Removes RNA and replaces with DNA Fuses or "glues" fragments of DNA together Proofreads or edits the DNA, checking for mistakes Given the following, DNA Sequence, what is the new daughter strand? (Did you label the 5' and 3' ends?) What is the name of the "fragments" of DNA on the lagging strand after...
Most questions answered within 3 hours.
-
A reading specialist wants to identify third-graders who scored
at the lowest 10% on a standardized...
asked 20 seconds ago -
a swimming pool is 20 ft wide and 40 ft long. The bottom of the
pool...
asked 2 minutes ago -
Prelab Problem: You have a parallel plate capacitor
with circular plates of radius
r = 10.0...
asked 24 minutes ago -
Fine Furniture, Inc. is a furniture manufacturer located in
Norfolk, Virginia. Fine enters into a contract...
asked 21 minutes ago -
Business Ethics
Who are those codes aimed at? Is that believable?
asked 19 minutes ago -
When a black hole of mass M1 merges with a black hole of mass
M2, it...
asked 29 minutes ago -
use
hardy wineberg equation to find equilbrium.
AA 150. Aa 120. aa 90
asked 49 minutes ago -
Why don't law enforcement or prosecutors always investigate
crimes as hate crimes
asked 40 minutes ago -
Describe how Rio Tinto is a main competitor of BHP.
asked 43 minutes ago -
Two children (m = 31.0 kg each) stand opposite each other on the
edge of a...
asked 50 minutes ago -
A 2180-kg car is slowed down uniformly from 24.6 m/s to 5.2 m/s
in 3.32 s....
asked 1 hour ago -
Jesse’s Machining is looking to buy a new machine to handle a
new four-year contract for...
asked 1 hour ago