"A protein is made from a messenger RNA of the following sequence. What is the sequence...
"A protein is made from a messenger RNA of the following sequence. What is the sequence of amino acids for this protein? (Remember, a start and a stop codon are needed for a protein to be made).
3' G C C G A U G G A U G A A G U U U U A A A G U A A U A G C A A U G G A G G A C 5'"
|
(amino) met - thr - phe - ser - ser - arg |
||
|
(amino) met - val - glu - val - leu - glu |
||
|
(amino) met - lys - phe |
||
|
(amino) met - arg - ile - ser - val - cys |
||
|
(amino) met - asp - glu - val - leu lys |
Homework Answers
Answer:
(amino) met - lys – phe
Explanation:
3' G C C G A U G G A U G A A G U U U U A A A G U A A U A G C A A U G G A G G A C 5'
Write the mRNA in revers order as 5’ to 3’ and starts with AUG codon.
5’-CAGGAGGUAACGAUAAUGAAAUUUUGAAGUAGGUAGCCG -3’
mRNA—5’AUG-AAA-UUU-UGA-AGUAGGUAGCCG -3’
Peptide: (amino) Met-Lys-Phe-STOP
Add Answer to:
"A protein is made from a messenger RNA of the following
sequence. What is the sequence...
This sequence is RNA because:
20. This sequence is RNA because:A) it is single stranded.B) it contains U (uracil) and no T (thymine).C) it runs in a 5' to 3' direction.D) it codes for amino acids.E) it is a small molecule.21. Which amino acids does this sequence code for, if the reading frame is as shown, starting from the correct end? A) gly-ala-arg-cys-ile...B) pro-arg-ala-thr-stopC) met-asn-glu-leu...D) glu-leu-val-val-phe...E) leu-glu-gln-his-asn...22. If the sequence gets changed to 5' ... GGAGACUCGUUGUAUU... 3'. What would be the effect on the amino...
Table 1: Partial RPE65 protein sequence (amino acids 41-60) for the 9-year-old LCA patient. Unmutated Protein...
Table 1: Partial RPE65 protein sequence (amino acids 41-60) for the 9-year-old LCA patient. Unmutated Protein Sequence Patient's Allele 1 Protein Sequence Patient's Allele 2 Protein Sequence START...Ser-Leu-Leu-Arg-Cyc-Gly-Pro-Gly-Leu-Phe-Glu-Val-Gly-Ser-Glu-Pro-Phe-Tyr- His-Gly...STOP START...Ser-Leu-Leu-Gin-Cyc-Gly-Pro-Gly-Leu-Phe-Glu-Val-Gly-Ser-Glu-Pro-Phe-Tyr- His-Gly...STOP START...Ser-Leu-Leu-Gin-Cyc-Gly-Pro-Gly-Leu-Phe-Glu-Val-Gly-Ser-Glu-Pro-Phe-Tyr- His-Gly...STOP Table 2. Partial RPE65 protein sequence (amino acids 61-70 and 291–300) for the 11-year-old LCA patient. Unmutated Protein Sequence Patient's Allele 1 Protein Sequence Patient's Allele 2 Protein Sequence START...Phe-Asp-Gly-Gln-Ala-Leu-Leu-His-Lys-Phe...lle-Ala-Asp-Lys-Lys-Arg-Lys-Lys- Tyr-Leu...STOP START...Phe-Asp-Gly-Gln-Ala-Leu-Leu-Tyr-Lys-Phe...lle-Ala-Asp-Lys-Lys-Arg-Lys-Lys- Tyr-Leu...STOP START...Phe-Asp-Gly-Gln-Ala-Leu-Leu-His-Lys-Phe...lle-Ala-Asp-Lys-STOP Source: Data from Russell et al. (2017). Use Tables 1 and 2 to...
What amino acid would the Manticodon code for RNA codon table 2nd position Tot position СТА...
What amino acid would the Manticodon code for RNA codon table 2nd position Tot position СТА Tyr Phe Phe > eu eu Oulaa Jooo 9999 stop stop eu eu eu Let 0 - puchbucobucusura BER < Val Val Asp Ala Asp Ala Glu Ala Glu Amino Acids Keu Pro Pro His Weu Leu Gin lle Pro Thr Thr Thr Thr Asn Asn lle Ser Ser Arg lle Met Lys Lys bucoucouco Arg > Asp Asp Val Val Val Val Ala...
Table 1: Partial RPE65 protein sequence (amino acids 41-60) for the 9-year-old LCA patient. Unmutated Protein...
Table 1: Partial RPE65 protein sequence (amino acids 41-60) for the 9-year-old LCA patient. Unmutated Protein Sequence Patient's Allele 1 Protein Sequence Patient's Allele 2 Protein Sequence START...Ser-Leu-Leu-Arg-Cyc-Gly-Pro-Gly-Leu-Phe-Glu-Val-Gly-Ser-Glu-Pro-Phe-Tyr- His-Gly...STOP START...Ser-Leu-Leu-Gin-Cyc-Gly-Pro-Gly-Leu-Phe-Glu-Val-Gly-Ser-Glu-Pro-Phe-Tyr- His-Gly...STOP START...Ser-Leu-Leu-Gin-Cyc-Gly-Pro-Gly-Leu-Phe-Glu-Val-Gly-Ser-Glu-Pro-Phe-Tyr- His-Gly...STOP Table 2. Partial RPE65 protein sequence (amino acids 61-70 and 291-300) for the 11-year-old LCA patient. Unmutated Protein Sequence Patient's Allele 1 Protein Sequence Patient's Allele 2 Protein Sequence START...Phe-Asp-Gly-Gln-Ala-Leu-Leu-His-Lys-Phe...lle-Ala-Asp-Lys-Lys-Arg-Lys-Lys- Tyr-Leu...STOP START...Phe-Asp-Gly-In-Ala-Leu-Leu-Tyr-Lys-Phe...Ile-Ala-Asp-Lys-Lys-Arg-Lys-Lys- Tyr-Leu...STOP START...Phe-Asp-Gly-Gln-Ala-Leu-Leu-His-Lys-Phe...lle-Ala-Asp-Lys-STOP Source: Data from Russell et al. (2017). Use Tables 1 and 2 to...
Question 10 (15 points) Given the following sequence for a template strand of DNA 3 -...
Question 10 (15 points) Given the following sequence for a template strand of DNA 3 - ATACTTTGTCGAGACCCGCTTCTTGCAGACTGGG A. Provide the mRNA sequence following transcription (include polarity) B. Provide the amino acid sequence using either the one letter or three letter abbreviations. Include polarity (N-or C-terminus) and be careful to start in the correct place: C. What if the "C" underlined above was changed to a T. What is the new codon? How does that affect the amino acid sequence? What...
The next DNA sequence is the MATRICE strand of a small gene. What is the complete...
The next DNA sequence is the MATRICE strand of a small gene. What is the complete amino acid sequence of the encoded peptide? GTCATGGCAACATAG 5'-3 Standard Genetic Code First position (5'end) U Second position UAU Tyr UAC Tyr UCA Ser UAA StopUGA Stop UAG Stop UUU Phe UUC Phe UUA Leu UUG Leu UGU Cys UGC Cys UCU Ser UCC Ser UCG Ser UGG Trp CUU Leu CUC Leu CUA Leu CUG Leu CCU Pro CCC Pro CCA Pr CCG...
A protein with the sequence below forms an alpha-helix. How many turns are made in the...
A protein with the sequence below forms an alpha-helix. How many turns are made in the helix? Explain why the properties of the amino acids in this helix result in an amphipathic protein. How might this amphipathic alpha-helix associate with the membrane? Leu-Lys-Arg-Ile-Val-Asp-Thr-Ile-Leu-Ser-Arg-Leu-Phe-Lys
repulsion within the protein 10. Which of the following amino acids do not contain a chiral...
repulsion within the protein 10. Which of the following amino acids do not contain a chiral carbon? a. Proline b. Alanine c. Glycine d. Phenylalanine e. Tyrosine 11. You want to determine an amino acid sequence for a particular polypeptide. So you degrade the peptid and get the following fragments. Determine the peptide sequence. Digested with typsin: Met-Val-Ser-Thr-Lys Val-lle-Trp-Thr-Leu-Met-lle Leu-Phe-Asn-Glu-Ser-Arg Digested with chymotrypsin: Asn-Glu-Ser-Arg-Val-lle-Trp Thr-Leu-Met-lle Met-Val-Ser-Thr-Lys-Leu-Phe a. Val-lle-Trp-Thr-Leu-Met-lle-Leu-Phe-Asn-Glu-Ser-Arg-Met-Val-Ser-Thr-Lys b. Val-lle-Trp-Thr-Leu-Met-lle-Met-Val-Ser-Thr-Lys-Leu-Phe-Asn-Glu-Ser-Arg c. Leu-Phe-Asn-Glu-Ser-Arg-Met-Val-Ser-Thr-Lys-Val-lle-Trp-Thr-Leu-Met-le d. Met-Val-Ser-Thr-Lys-Leu-Phe-Asn-Glu-Ser-Arg-Val-le-Trp-Thr-Leu-Met-lle e. Met-Val-Ser-Thr-Lys-Val-lle-Trp-Thr-Leu-Met-lle-Leu-Phe-Asn-Glu-Ser-Arg
Please answer thoroughly, will rate thumbs up. thanks Q1. Consider the following protein sequence: Leu-Lys-Val-Asp-Ile-Ser-Leu-Arg-Leu-Lys-Ile-Arg-Phe-Glu. What...
Please answer thoroughly, will rate thumbs up. thanks Q1. Consider the following protein sequence: Leu-Lys-Val-Asp-Ile-Ser-Leu-Arg-Leu-Lys-Ile-Arg-Phe-Glu. What is special about the arrangement of the amino acids in these sequences when incorporated into a Beta sheet? What prediction can you make about how this Beta sheet might be arranged in a cytoplasmic protein. Q2. Consider the following protein sequence as an Alpha-helix: Leu-Lys-Arg-Ile-Val-Asp-Ile-Leu-Ser-Arg-Leu-Phe-Lys-Val. What is special about the arrangement of the amino acids in these sequences when folded into alpha helix?
How many amino acids are there in the disease causing variant of the Amyloid-beta (Ab) peptide?...
How many amino acids are there in the disease causing variant of
the Amyloid-beta (Ab) peptide?
Determine which of these four peptides is most likely to become a beta sheet. Lys-Thr-Val-Ile-Trp-Pro-Phe-Tyr-Ile-Gln-Ile-Gly Arg-Ser-Tyr-Glu-Gly-Leu-Lys-Arg-Ile-Ala-Glu-Ser Ala-Glu-Met-Leu-Gln-Lys-Arg-Gly-Cys-Gly-Asp-Glu Met-Leu-Lys-Ala-Ser-Ala-Leu-Glu-Lys-Leu-Ser-Glu
Table 1: Partial RPE65 protein sequence (amino acids 41-60) for the 9-year-old LCA patient. Unmutated Protein Sequence Patient's Allele 1 Protein Sequence Patient's Allele 2 Protein Sequence START...Ser-Leu-Leu-Arg-Cyc-Gly-Pro-Gly-Leu-Phe-Glu-Val-Gly-Ser-Glu-Pro-Phe-Tyr- His-Gly...STOP START...Ser-Leu-Leu-Gin-Cyc-Gly-Pro-Gly-Leu-Phe-Glu-Val-Gly-Ser-Glu-Pro-Phe-Tyr- His-Gly...STOP START...Ser-Leu-Leu-Gin-Cyc-Gly-Pro-Gly-Leu-Phe-Glu-Val-Gly-Ser-Glu-Pro-Phe-Tyr- His-Gly...STOP Table 2. Partial RPE65 protein sequence (amino acids 61-70 and 291–300) for the 11-year-old LCA patient. Unmutated Protein Sequence Patient's Allele 1 Protein Sequence Patient's Allele 2 Protein Sequence START...Phe-Asp-Gly-Gln-Ala-Leu-Leu-His-Lys-Phe...lle-Ala-Asp-Lys-Lys-Arg-Lys-Lys- Tyr-Leu...STOP START...Phe-Asp-Gly-Gln-Ala-Leu-Leu-Tyr-Lys-Phe...lle-Ala-Asp-Lys-Lys-Arg-Lys-Lys- Tyr-Leu...STOP START...Phe-Asp-Gly-Gln-Ala-Leu-Leu-His-Lys-Phe...lle-Ala-Asp-Lys-STOP Source: Data from Russell et al. (2017). Use Tables 1 and 2 to...
What amino acid would the Manticodon code for RNA codon table 2nd position Tot position СТА Tyr Phe Phe > eu eu Oulaa Jooo 9999 stop stop eu eu eu Let 0 - puchbucobucusura BER < Val Val Asp Ala Asp Ala Glu Ala Glu Amino Acids Keu Pro Pro His Weu Leu Gin lle Pro Thr Thr Thr Thr Asn Asn lle Ser Ser Arg lle Met Lys Lys bucoucouco Arg > Asp Asp Val Val Val Val Ala...
Table 1: Partial RPE65 protein sequence (amino acids 41-60) for the 9-year-old LCA patient. Unmutated Protein Sequence Patient's Allele 1 Protein Sequence Patient's Allele 2 Protein Sequence START...Ser-Leu-Leu-Arg-Cyc-Gly-Pro-Gly-Leu-Phe-Glu-Val-Gly-Ser-Glu-Pro-Phe-Tyr- His-Gly...STOP START...Ser-Leu-Leu-Gin-Cyc-Gly-Pro-Gly-Leu-Phe-Glu-Val-Gly-Ser-Glu-Pro-Phe-Tyr- His-Gly...STOP START...Ser-Leu-Leu-Gin-Cyc-Gly-Pro-Gly-Leu-Phe-Glu-Val-Gly-Ser-Glu-Pro-Phe-Tyr- His-Gly...STOP Table 2. Partial RPE65 protein sequence (amino acids 61-70 and 291-300) for the 11-year-old LCA patient. Unmutated Protein Sequence Patient's Allele 1 Protein Sequence Patient's Allele 2 Protein Sequence START...Phe-Asp-Gly-Gln-Ala-Leu-Leu-His-Lys-Phe...lle-Ala-Asp-Lys-Lys-Arg-Lys-Lys- Tyr-Leu...STOP START...Phe-Asp-Gly-In-Ala-Leu-Leu-Tyr-Lys-Phe...Ile-Ala-Asp-Lys-Lys-Arg-Lys-Lys- Tyr-Leu...STOP START...Phe-Asp-Gly-Gln-Ala-Leu-Leu-His-Lys-Phe...lle-Ala-Asp-Lys-STOP Source: Data from Russell et al. (2017). Use Tables 1 and 2 to...
Question 10 (15 points) Given the following sequence for a template strand of DNA 3 - ATACTTTGTCGAGACCCGCTTCTTGCAGACTGGG A. Provide the mRNA sequence following transcription (include polarity) B. Provide the amino acid sequence using either the one letter or three letter abbreviations. Include polarity (N-or C-terminus) and be careful to start in the correct place: C. What if the "C" underlined above was changed to a T. What is the new codon? How does that affect the amino acid sequence? What...
The next DNA sequence is the MATRICE strand of a small gene. What is the complete amino acid sequence of the encoded peptide? GTCATGGCAACATAG 5'-3 Standard Genetic Code First position (5'end) U Second position UAU Tyr UAC Tyr UCA Ser UAA StopUGA Stop UAG Stop UUU Phe UUC Phe UUA Leu UUG Leu UGU Cys UGC Cys UCU Ser UCC Ser UCG Ser UGG Trp CUU Leu CUC Leu CUA Leu CUG Leu CCU Pro CCC Pro CCA Pr CCG...
repulsion within the protein 10. Which of the following amino acids do not contain a chiral carbon? a. Proline b. Alanine c. Glycine d. Phenylalanine e. Tyrosine 11. You want to determine an amino acid sequence for a particular polypeptide. So you degrade the peptid and get the following fragments. Determine the peptide sequence. Digested with typsin: Met-Val-Ser-Thr-Lys Val-lle-Trp-Thr-Leu-Met-lle Leu-Phe-Asn-Glu-Ser-Arg Digested with chymotrypsin: Asn-Glu-Ser-Arg-Val-lle-Trp Thr-Leu-Met-lle Met-Val-Ser-Thr-Lys-Leu-Phe a. Val-lle-Trp-Thr-Leu-Met-lle-Leu-Phe-Asn-Glu-Ser-Arg-Met-Val-Ser-Thr-Lys b. Val-lle-Trp-Thr-Leu-Met-lle-Met-Val-Ser-Thr-Lys-Leu-Phe-Asn-Glu-Ser-Arg c. Leu-Phe-Asn-Glu-Ser-Arg-Met-Val-Ser-Thr-Lys-Val-lle-Trp-Thr-Leu-Met-le d. Met-Val-Ser-Thr-Lys-Leu-Phe-Asn-Glu-Ser-Arg-Val-le-Trp-Thr-Leu-Met-lle e. Met-Val-Ser-Thr-Lys-Val-lle-Trp-Thr-Leu-Met-lle-Leu-Phe-Asn-Glu-Ser-Arg
How many amino acids are there in the disease causing variant of
the Amyloid-beta (Ab) peptide?
Determine which of these four peptides is most likely to become a beta sheet. Lys-Thr-Val-Ile-Trp-Pro-Phe-Tyr-Ile-Gln-Ile-Gly Arg-Ser-Tyr-Glu-Gly-Leu-Lys-Arg-Ile-Ala-Glu-Ser Ala-Glu-Met-Leu-Gln-Lys-Arg-Gly-Cys-Gly-Asp-Glu Met-Leu-Lys-Ala-Ser-Ala-Leu-Glu-Lys-Leu-Ser-Glu
Most questions answered within 3 hours.
-
An economist claims that he has found evidence to support the
assumption that the investment expenditure...
asked 14 minutes ago -
Question 10 (1 point)
Suppose that a researcher studying the weight of female college
athletes wants...
asked 1 hour ago -
a. Using your
molecular modeling kit, build a model of sucrose. Locate the oxygen
bridge in...
asked 1 hour ago -
Below is a
linear time complexity algorithm Max-Min-VER1 to find the biggest
and smallest element a...
asked 1 hour ago -
A women tries to swim perpendicular across the river to the
opposite bank at 2.0m/s with...
asked 2 hours ago -
The amount of time it takes for a student to complete a
statistics quiz is uniformly...
asked 3 hours ago -
True or False: If some system undergoes a reversible,
isothermal
process, then its entropy must remain...
asked 2 hours ago -
You are analyzing the after-tax cost of debt for a firm. You
know that the firm’s...
asked 2 hours ago -
You
are dining with a friend and use the friend's spoon to taste her
food, if...
asked 3 hours ago -
explain why The elasticity of demand for labor is higher the
higher the elasticity of supply...
asked 3 hours ago -
Hi just need to know if these statements are true or false and
why!!!
1. Magnetic...
asked 3 hours ago -
A radar transmits a pulse every 0.5
ms. It transmits an up-chirp of the duration of...
asked 3 hours ago