Question

1. If tryptophan interacts with a repressor protein (which it does in real life) and the...

1. If tryptophan interacts with a repressor protein (which it does in real life) and the trp operon is anabolic (which it is)

a. What would happen to tryptophan production levels and energy expenditure in a mutant bacterial cell that had a repressor protein that was incapable of binding to tryptophan (but was normal in every other way)

b. What would happen to tryptophan production levels and energy expenditure in a mutant bacterial cell that had a repressor protein that was incapable of binding to the operator (but was normal in every other way)

c. What would happen to tryptophan production levels and energy expenditure in a mutant bacterial cell that had a repressor protein that was incapable of letting go of tryptophan?

0 0
Add a comment Improve this question Transcribed image text
Answer #1

Tryptophan (trp) operon is an anabolic operon. In the presence of Trp, it is repressed by Trp repressor which binds to the operator and prevents the binding of RNA polymerase to the promotor.
In the absence of Trp, the repressor is unable to bind to the operator. Hence RNA polymerase can bind to the promoter and mediate transcription of structural genes.

i. If the repressor protein is unable to bind to Trp, it will lead to the constitutive activation of the operon. This is due to the fact that the repressor can bind to the operator only in complex with Trp.

ii. If the repressor protein is unable to bind to the operator, it will lead to the constitutive activation of the operon. This is due to the fact that the repressor binding to the operator essential to prevent RNA polymerase binding to the promoter.

iii. If the repressor protein is unable to let go of Trp, it will lead to the constitutive repression of the operon. This is due to the fact that the repressor can be relieved from the operator only when Trp is removed from it.

Add a comment
Know the answer?
Add Answer to:
1. If tryptophan interacts with a repressor protein (which it does in real life) and the...
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Not the answer you're looking for? Ask your own homework help question. Our experts will answer your question WITHIN MINUTES for Free.
Similar Homework Help Questions
  • here is the diagram ecause there is no repressor protein attached to the operator, what enzyme...

    here is the diagram ecause there is no repressor protein attached to the operator, what enzyme con attach to the promoter and move past the operator to transcribe the structural genes? Color this enzyme pink "color the repressor gene purple and the repressor protein it codes for red. Examine the shape of the repressor protein. 45) Is it an active or inactiverepressor protein? The diagram below shows the trp operon when turned off." Repressor gene Promoter Operator Structural genes DNA...

  • a. Antibody is prepared to the thr repressor protein isolated from a wild-type strain. Competetive antibody...

    a. Antibody is prepared to the thr repressor protein isolated from a wild-type strain. Competetive antibody binding assays show that several times more repressor is present in an extract prepared from the derepressed mutant described above than in an extract prepared from the wild-type strain. What is your interpretation of these data? b. The repressor protein requires a pH of 6.1 for optimal binding to its operator in vitro. If the pH goes above pH 8.0, the repressor is unable...

  • Yet, all the cells in your body contain the same genes (and same alleles). The difference...

    Yet, all the cells in your body contain the same genes (and same alleles). The difference across cell types is that genes get selectively expressed (turned on or off) based on the proteins needed for cellular function given their environment. Select which statement explains the reason why hair does not normally grow on your muscle cells. a. Muscle cells have the gene for keratin, but do not express it b. Muscle cells do not have the gene for keratin and...

  • Which of the following is NOT expected when a eukaryotic cell is deprived from Oxygen? Question...

    Which of the following is NOT expected when a eukaryotic cell is deprived from Oxygen? Question 40 Not yet answered Points out of 2.50 P Flag question Select one: O a. The formation of CO2 from cell respiration stops o b. Reduction of the production of ATP by substrate level phosphorylation in the mitochondria c. All listed events are expected in a eukaryotic cell deprived of oxygen O d. The cell reduces pyruvate (fermentation) to allow the ETC to continue...

  • all them please Question 23 (1 point) The A and B alleles in ABO blood types...

    all them please Question 23 (1 point) The A and B alleles in ABO blood types can give rise to an individual that is blog type AB. This specific blood type is an example of: A) multiple alleles B) epistasis C) codominance D) partial dominance Imagine the gene encoding the lac repressor was mutated so that lactose (more technically allolactose) no longer bound to the repressor. However, the lac repressor was still capable of binding DNA at the operator sequence....

  • Microbiology study guide questions. Please Help! s. which of the following statements about water activity is not true? a) many fungi can tolerate aw levels of 07-0.8 b) many microorganisms grow...

    Microbiology study guide questions. Please Help! s. which of the following statements about water activity is not true? a) many fungi can tolerate aw levels of 07-0.8 b) many microorganisms grow well at an aw of 0.98 e sear water has an aw of 0.98 e-xerephiles thrive in dry conditions DNA typically becomes disordered below an a of o.90 Which of the following descriptions about ribosome structure is not true? a) 80s is the size of the intact functional ribosome...

  • please help me with the question 15 to 18. Basic structure of an operon Note that...

    please help me with the question 15 to 18. Basic structure of an operon Note that the diagram below is one section of DNA master strend with some areas of DNA labeled in blocks The bracketed area illustrates the basic parts of an operon repressor gene promoter operator structural genes DNA 3 mRNA 5 - 3 repressor protein shown attached to operator #2 Repressor preten "Use purple to color in the repressor gene. The repressor gene codes for a repressor...

  • 1. Which of the following organisms would produce functional lac products in the presence of IPTG?...

    1. Which of the following organisms would produce functional lac products in the presence of IPTG? A. Is Oc Z- Y+ A+ B. Is Oc Z- Y- A- C. I+ O+ Z+ Y+ A+ D. I-Oc Z+ Y+ A+ E. Both Is Oc Z- Y+ A+ and Is Oc Z- Y+ A+ are correct 2. Which of the following statements is true about a lac operon with this genotype? I-d O+ Z+ Y- A- A. The operon is repressible. B....

  • Shown below is the trp mRNA leader. (A) How does attenuation in the trp operon work...

    Shown below is the trp mRNA leader. (A) How does attenuation in the trp operon work to control the levels of Trpe peptide? What happens when tryptophan levels are high in the cell? When they are low? (drawings may be used to assist in your explanation)(B) Does this happen in eukaryotes, prokaryotes or both? Why? (6 pts) Leader peptide Met-Lys - Al-te-Phe Val- mRNA PPPAAGUUCACGUAAAAAGGGUAUCGACAAUGAAAGCAAUUUUCGUACUGA GUAGUA MARCGAAAUGCGUACCACUUAUGUGACGGGCAANGUCCUUCACGCGGUGGU stop)-Ser-Thr-Arg - Trp - Top- ACCCAGCCCGCCUAAUGAGCGGGCUUUUUUUUGAACAAAAUUAGAGAAUAAGAAUGCAAACA Met-Gin-The- Trpt polypeptide Site of transcription attenuation...

  • For Questions 4-18, consider the mutations described in the left-hand column below. Identify whether the Lac operon will be ON or OFF in each of the environments listed across the top. The expression...

    For Questions 4-18, consider the mutations described in the left-hand column below. Identify whether the Lac operon will be ON or OFF in each of the environments listed across the top. The expression of the normal (wild type) operon is given. Note that "ON" and "OFF" refer to whether the operon is expressed at high levels (ON) or basal//low/no levels (OFF). (Hint: mutations render the indicated site inactive while leaving the remaining part of the operon or protein functional.) Note...

ADVERTISEMENT
Free Homework Help App
Download From Google Play
Scan Your Homework
to Get Instant Free Answers
Need Online Homework Help?
Ask a Question
Get Answers For Free
Most questions answered within 3 hours.
ADVERTISEMENT
ADVERTISEMENT
ADVERTISEMENT