ZuoTi.Pro
Question

Assume that the two UGG codons in the leader sequence of the trp operon are changed...

Assume that the two UGG codons in the leader sequence of the trp operon are changed to UGC. What will be the effect of this mutation on the synthesis of the Trp biosynthetic enzymes in the presence and absence of tryptophan?

science   biology   
0 0
Add a comment Improve this question Transcribed image text
Next > < Previous
Sort answers by oldest

Homework Answers

Answer #1

The presence of the Trp codon in the leader sequence helps as a molecular sensor of the presence of tryptophan in the cell. There are 3 stem-loop formation is possible in the mRNA of trp operon, stem-loop between region, 1-2, 2-3 and 3-4. among them the stem-loop 3-4 is a transcription termination signal.

Now, if the cell contains an abundant of tryptophan, then at the leader sequence trp is incorporated at the time of translation, and the ribosome can get pass the region 2 and 3-4 stemloop is formed (as 2-3 can not form because of the presence of ribosome over the region 2) within the mRNA which terminates the transcription.

But if cell does not have enough trp, the ribosome will not be able to get pass the leader sequence, so stem-loop 2-3 will be formed and as a result formation of stemloop 3-4 will not be possible. So, the transcription will continue.

Now, if the two UGG codons in the leader sequence of the trp operon are changed to UGC, the synthesis of the Trp biosynthetic enzymes will not be affected irrespective of presence or absence of tryptophan.

0 0
Add a comment
Know the answer?
Add Answer to:
Assume that the two UGG codons in the leader sequence of the trp operon are changed...
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Log In

Sign Up

Not the answer you're looking for? Ask your own homework help question. Our experts will answer your question WITHIN MINUTES for Free.
Similar Homework Help Questions

  • Trp Operon 5. The rate of transcription of the trp operon in E. coli is controlled by both repression and attenuation dr papde ia) Alternate secondary structures formed by the trpl tranecript Alterna...

    Trp Operon 5. The rate of transcription of the trp operon in E. coli is controlled by both repression and attenuation dr papde ia) Alternate secondary structures formed by the trpl tranecript Alternate 2 Regions 2 and 3 Atemate 1: Regions 1 and 2 basepared and regions 3 and 4 basepsired 54 140 Stop codon Transcribtion termination hairpin can NOT form a) Diagram and explain repression and attenuation regulatory mechanisms for the trp operon when tryptophan is present and absent....

  • 1. (1 points) A deletion mutation in the leader sequence of the trp operon removes the...

    1. (1 points) A deletion mutation in the leader sequence of the trp operon removes the two tryptophan codons that are involved in attenuation. Predict the effect of this mutation on the expression of the trp structural genes in E. coli cells grown in media that lacks tryptophan. 2. (2 points) What protein family members are the main protein components of the RISC complex? How does the RISC complex target specific mRNAs for silencing? 3. (3 points) In bacteria, the...

  • Two mutations of the Trp operon are identified. In mutant A, the operator sequence has changed...

    Two mutations of the Trp operon are identified. In mutant A, the operator sequence has changed and the repressor is not able to bind, while as in mutant B the tryptophan is not able to bind the repressor For the phrase below choose the appropriate answer: These cells are able to synthesize tryptophan Mutant A Mutant B Both Mutant A and Mutant B Neither Mutant A nor Mutant B QUESTION 63 Two mutations of the Trp operon are identified. In...

  • A mutation in the operator of the trp operon prevents the repressor to bind to the...

    A mutation in the operator of the trp operon prevents the repressor to bind to the operator, even in the presence of tryptophan. What is true with respect to the bacteria carrying this mutation? Select one: a. The bacteria will transcribe the genes of the trp operon even when tryptophan is present in the environment b. Tryptophan would not be able to bind to the repressor protein c. Small amounts of tryptophan will be lethal for the bacteria d. The...

  • 1. Tryptophan (Trp) is encoded by the codon UGG. Suppose that a cell was treated with...

    1. Tryptophan (Trp) is encoded by the codon UGG. Suppose that a cell was treated with high levels of 5-Bromouracil such that mutations were induced at Trp codons. Would you expect that these mutations would results in a non-sense mutation, a silent mutation, a missense mutation. Explain your answer.What is a tautomeric shift and explain how it contributes to transition mutations? 2.Draw the structure of the rare tautomeric enol form of guanine. Draw the structure of the monophosphate deoxynucleotide which...

  • Page < 2 > of 2 D. The trp operon would be expressed at high levels,...

    Page < 2 > of 2 D. The trp operon would be expressed at high levels, comparable to its expression in the absence of trp 6. Based upon what you have learned about the E. coli trp operon, what could you say about expression of its structural genes in cells with large amounts of environmental trp, but expressing a mutant trp repressor that is unable to bind trp? A. The trp operon would be completely repressed due to the abundance...

  • expressed at high levels, comparable to its expression in the absence of trp 6. Based upon...

    expressed at high levels, comparable to its expression in the absence of trp 6. Based upon what you have learned about the E. coli trp operon, what could you say about expression of its structural genes in cells with large amounts of environmental trp, but expressing a mutant trp repressor that is unable to bind trp? A. The trp operon would be completely repressed due to the abundance of trp B. The trp operon would be transcribed much less than...

  • Shown below is the trp mRNA leader. (A) How does attenuation in the trp operon work...

    Shown below is the trp mRNA leader. (A) How does attenuation in the trp operon work to control the levels of Trpe peptide? What happens when tryptophan levels are high in the cell? When they are low? (drawings may be used to assist in your explanation)(B) Does this happen in eukaryotes, prokaryotes or both? Why? (6 pts) Leader peptide Met-Lys - Al-te-Phe Val- mRNA PPPAAGUUCACGUAAAAAGGGUAUCGACAAUGAAAGCAAUUUUCGUACUGA GUAGUA MARCGAAAUGCGUACCACUUAUGUGACGGGCAANGUCCUUCACGCGGUGGU stop)-Ser-Thr-Arg - Trp - Top- ACCCAGCCCGCCUAAUGAGCGGGCUUUUUUUUGAACAAAAUUAGAGAAUAAGAAUGCAAACA Met-Gin-The- Trpt polypeptide Site of transcription attenuation...

  • 3. Consider a hypothetical strain of E. coli (strain 401) that contains two mutations that affect...

    3. Consider a hypothetical strain of E. coli (strain 401) that contains two mutations that affect tryptophan biosynthesis. The first mutation is a single nucleotide substitution that converts the second tandem Trp codon in region 1 of the Trp leader sequence into a stop codon (see slides 2-7 of Lecture 24 on iLearn) trp structural genes trpE trpD trpC trpB trpA PO Trp Leader Met-Lys-Ala-lle-Phe-Val-Leu-Lys-Gly-Trp-Trp-Arg-Thr Ser- Stop Assume that strain 401 also contains a mutation in the gene for the...

  • Two RNA sequences that can cause premature transcription termination are the trp leader sequence (trp L)...

    Two RNA sequences that can cause premature transcription termination are the trp leader sequence (trp L) in E. coli and the thi riboswitch in B. subtilis. For each of these RNAs, discuss how alternate secondary structures impact termination and describe the conditions that favor each of the alternate secondary structures.

ADVERTISEMENT
Free Homework Help App
Download From Google Play
Scan Your Homework
to Get Instant Free Answers
Need Online Homework Help?
Ask a Question
Get Answers For Free
Most questions answered within 3 hours.
ADVERTISEMENT
ADVERTISEMENT
ADVERTISEMENT