Indicate the amino acid sequence of the protein encoded by the following mRNA molecule. Use the...
Indicate the
amino acid
sequence of the protein encoded by the following mRNA molecule. Use the genetic
code table and assume that the very first “AUG” the ribosome encounters will serve as the start codon.
5’-AAUUCAUGCCCAAAUUUGGGGCACGAAGCUUCUUAGGCUAGUCCUAAAAAA-3’
Homework Answers
Add Answer to:
Indicate the
amino acid
sequence of the protein encoded by the following mRNA molecule.
Use the...
2. A (1 pt) Using the Genetic Code table, determine the peptide that is encoded by...
2. A (1 pt) Using the Genetic Code table, determine the peptide that is encoded by the part of the mRNA molecule shown. Use the three-letter designation for amino acids. Start with the first start codon the ribosome would translate, and end at a stop codon 5'-CUGCGAUGAUUAGCCUAAUGGUUGAGAGUUGAUAGGCG-3 B. (0.25 pt) If this is a eukaryotic mRNA, would the TATA box present in the full-length transcript?
Question 9: The genetic code is read in groups of three nucleotides, called codons, in mRNA...
Question 9:
The genetic code is read in groups of three nucleotides, called
codons, in mRNA that specifies for a particular amino acid.
tRNA molecules act as the amino acid carriers that by correctly
pairing with the codon on mRNA can deliver the correct amino acid
to the ribosome during translation. At the tip of each tRNA
molecule is a group of three nucleotides called an anticodon and at
the other end is where the corresponding amino acid is attached...
The following is a fragment of double-stranded DNA. It encodes a hypothetical 6 amino acid protein...
The following is a fragment of double-stranded DNA. It encodes a hypothetical 6 amino acid protein and includes the start (initiator) codon, a small amount of 5' UTR, and a small amount of 3' UTR. TTGGCAATGTGATCCCTTGTGCGGTACCACT AACCGTTACACTAGGGAACACGCCATGGTGA The bottom strand is the template, and the RNA polymerase moves along the bottom (template) strand from RIGHT TO LEFT. a) Determine the orientation of the DNA template. The template strand is copied below. (Enter either 5' or 3' in the box below,...
3. The mRNA base sequence below codes for part of a protein. Using the genetic code...
3. The mRNA base sequence below codes for part of a protein. Using the genetic code table in your text (p. 731 or the inside back cover), determine the amino acid sequence encoded by this piece of mRNA. (13 pts) mRNA: CAU GAA CU ACCUA GUGCU GUUGAA AU CAC CGCGCUCCU A protein:
What is a function of an AUG codon other than to start a new protein-coding sequence?...
What is a function of an AUG codon other than to start a new protein-coding sequence? Why is the nearly universal genetic code an indication that all of life had a single origin? How long would the mRNA need to be if it coded for a 150-amino-acid-long protein? Which codon position is most often responsible for the redundancy of the genetic code
Below is the mRNA sequence for the mRNA transcript used as the blueprint to make a...
Below is the mRNA sequence for the mRNA transcript used as the blueprint to make a specific protein. Write the DNA leading strain sequence, complimentary lagging stain sequence, and the protein with the amino acid sequence. Use the Codon Table provided. The mRNA transcript is provided for you. Leading strain : 5’ Lagging strain: 3’ mRNA transcript:5’ AUG UAC UAG GGC CCA AUU GAA ACG GGG ACC CCA GCC UGA3’ protein amino acid:
20. Given the following DNA sequence, write the complementary RNA sequence then the amino acid sequence...
20. Given the following DNA sequence, write the complementary RNA sequence then the amino acid sequence (hint: use the genetic code to translate from mRNA to protein!) DNA sequence: 3’- TACA A AGGUCTCCITAUGATC-5° mRNA: amino acid:
C++: Translating mRNA sequence help Homework Description Codon 1 You are working in a bioinformatics lab...
C++: Translating mRNA sequence help
Homework Description Codon 1 You are working in a bioinformatics lab studying messenger RNA (mRNA) sequences. mRNA is a sequence of the nucleotide bases (Adenine, Cytosine, Guanine, and Uracil) that conveys information stored in DNA to Ribosomes for translation into proteins. The bases in the sequences are denoted by the first letters of the nucleotide bases (e.g. A, C, G, and U). A sequence of mRNA is made up of hundres to thousands of nucleotide...
DNA, Genes and Protein Synthesis Activity 13: Protein Synthesis is the process by which cells produce (synthesize) proteins. An overview of the process is shown in model 2 (below). Gone 2...
DNA, Genes and Protein Synthesis Activity 13: Protein Synthesis is the process by which cells produce (synthesize) proteins. An overview of the process is shown in model 2 (below). Gone 2 Gene 1 Gene 3 DNA strand3 TRANSLATION Protein Trp Gly Model 2 ACTIVITY and QUESTIONS 1. Based on the information you can gather from model 1 complete the following sentences: a. The nucleotide Adenine (A) always pairs with the nucleotide b. The nucleotide Guanine (G) always pairs with the...
How many different mRNA sequences can code for a polypeptide chain with the amino acid sequence...
How many different mRNA sequences can code for a polypeptide chain with the amino acid sequence Met - Leu - Arg? Be sure to include a stop codon. Explain your answer! 5′ ...GGAGCUCGUUGUAUU... 3′ Is this sequence RNA or DNA? How can you tell? Which amino acids are encoded, if the reading frame is as shown, starting from the correct end? What would be the effect on the amino acid sequence if the sequence were changed to 5′ GGAGACUCGUUGUAUU 3′?...
2. A (1 pt) Using the Genetic Code table, determine the peptide that is encoded by the part of the mRNA molecule shown. Use the three-letter designation for amino acids. Start with the first start codon the ribosome would translate, and end at a stop codon 5'-CUGCGAUGAUUAGCCUAAUGGUUGAGAGUUGAUAGGCG-3 B. (0.25 pt) If this is a eukaryotic mRNA, would the TATA box present in the full-length transcript?
Question 9:
The genetic code is read in groups of three nucleotides, called
codons, in mRNA that specifies for a particular amino acid.
tRNA molecules act as the amino acid carriers that by correctly
pairing with the codon on mRNA can deliver the correct amino acid
to the ribosome during translation. At the tip of each tRNA
molecule is a group of three nucleotides called an anticodon and at
the other end is where the corresponding amino acid is attached...
The following is a fragment of double-stranded DNA. It encodes a hypothetical 6 amino acid protein and includes the start (initiator) codon, a small amount of 5' UTR, and a small amount of 3' UTR. TTGGCAATGTGATCCCTTGTGCGGTACCACT AACCGTTACACTAGGGAACACGCCATGGTGA The bottom strand is the template, and the RNA polymerase moves along the bottom (template) strand from RIGHT TO LEFT. a) Determine the orientation of the DNA template. The template strand is copied below. (Enter either 5' or 3' in the box below,...
3. The mRNA base sequence below codes for part of a protein. Using the genetic code table in your text (p. 731 or the inside back cover), determine the amino acid sequence encoded by this piece of mRNA. (13 pts) mRNA: CAU GAA CU ACCUA GUGCU GUUGAA AU CAC CGCGCUCCU A protein:
20. Given the following DNA sequence, write the complementary RNA sequence then the amino acid sequence (hint: use the genetic code to translate from mRNA to protein!) DNA sequence: 3’- TACA A AGGUCTCCITAUGATC-5° mRNA: amino acid:
C++: Translating mRNA sequence help
Homework Description Codon 1 You are working in a bioinformatics lab studying messenger RNA (mRNA) sequences. mRNA is a sequence of the nucleotide bases (Adenine, Cytosine, Guanine, and Uracil) that conveys information stored in DNA to Ribosomes for translation into proteins. The bases in the sequences are denoted by the first letters of the nucleotide bases (e.g. A, C, G, and U). A sequence of mRNA is made up of hundres to thousands of nucleotide...
DNA, Genes and Protein Synthesis Activity 13: Protein Synthesis is the process by which cells produce (synthesize) proteins. An overview of the process is shown in model 2 (below). Gone 2 Gene 1 Gene 3 DNA strand3 TRANSLATION Protein Trp Gly Model 2 ACTIVITY and QUESTIONS 1. Based on the information you can gather from model 1 complete the following sentences: a. The nucleotide Adenine (A) always pairs with the nucleotide b. The nucleotide Guanine (G) always pairs with the...
Most questions answered within 3 hours.
-
In which of the following cases is the displacement's
magnitude half the distance traveled? a. 10...
asked 4 minutes ago -
(InputMismatchException) and (ArrayIndexOutOfBoundsException):
Using the two arrays shown below, write a program that prompts the
user...
asked 14 seconds from now -
A basketball of mass m = 630 g rolls off the hoop's rim, falls
from a...
asked 19 minutes ago -
What is the activity [A] of Na+ in a .05M solution of NaCl at
25C? You...
asked 19 minutes ago -
You own a bond portfolio worth $41,000. You estimate that your
portfolio has an average YTM...
asked 28 minutes ago -
Assume a binomial probability distribution with n=40 and π=0.26.
Compute the following:
A.) The Mean and...
asked 33 minutes ago -
A 2.1-cm-tall object is 19.2 cm to the left of a lens with focal
length of...
asked 36 minutes ago -
In
EXCEL VBA:
How would I manage to do this in VBA?
The assignment is in...
asked 50 minutes ago -
what is the statistical probability of 2 caucasians
having identical STR profiles
asked 48 minutes ago -
A wheel with a radius of 0.5m starts to rotate from rest and
reaches full speed...
asked 54 minutes ago -
Why are short bones well suited to an area like the wrist? Why
are long bones...
asked 1 hour ago -
A uniform disk with mass m = 9.04 kg and radius R = 1.35 m lies...
asked 1 hour ago