ZuoTi.Pro
Question

2. A (1 pt) Using the Genetic Code table, determine the peptide that is encoded by the part of the mRNA molecule shown. Use the three-letter designation for amino acids. Start with the first start codon the ribosome would translate, and end at a stop codon 5-CUGCGAUGAUUAGCCUAAUGGUUGAGAGUUGAUAGGCG-3 B. (0.25 pt) If this is a eukaryotic mRNA, would the TATA box present in the full-length transcript?

science   biology   
0 0
Add a comment Improve this question Transcribed image text
Next > < Previous
Sort answers by oldest

Homework Answers

Answer #1

A) Metionine-isoleusine-serine-leusine-methionine-valine-glutamate-serine

Sterting with start codon AUG and ended with stop codon UGA.

B) If this is a eukaryotic mRNA then definitely the TATA box present.

0 0
Add a comment
Know the answer?
Add Answer to:
2. A (1 pt) Using the Genetic Code table, determine the peptide that is encoded by...
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Log In

Sign Up

Not the answer you're looking for? Ask your own homework help question. Our experts will answer your question WITHIN MINUTES for Free.
Similar Homework Help Questions

  • Indicate the amino acid sequence of the protein encoded by the following mRNA molecule. Use the...

    Indicate the amino acid sequence of the protein encoded by the following mRNA molecule. Use the genetic code table and assume that the very first “AUG” the ribosome encounters will serve as the start codon. 5’-AAUUCAUGCCCAAAUUUGGGGCACGAAGCUUCUUAGGCUAGUCCUAAAAAA-3’

  • 1. EORA BACTERIAL GENE, writing left-to-right, show the relative positions of each of these genetic elements...

    1. EORA BACTERIAL GENE, writing left-to-right, show the relative positions of each of these genetic elements as they would appear in the DNA from upstream on the left to downstream on the right. Of course, some of these genetic elements will only be active once they are in mRNA (e.g., the translational start codon), but they are still found encoded in the sequence of DNA onthe left the translational start colon . but they are s RBS ribosome binding site...

  • Question 2 (1 point) In order to target a protein to the endomembrane system, which of...

    Question 2 (1 point) In order to target a protein to the endomembrane system, which of the following is required first? O a ER bound ribosome signal peptide on the N terminus of the polypeptide chaperone protein signal peptide on the C terminus of the polypeptide O signal-recognition particles A tRNA is chemically modified so that the amino acid bound is different than the one specified by its anticodon. Which codon in the mRNA would the tRNA recognize: the one...

  • 1. Explain the difference between spontaneous and induced mutations. Give an example of how each might...

    1. Explain the difference between spontaneous and induced mutations. Give an example of how each might be caused 2. For the double stranded DNA molecule shown below, the BOTTOM strand is the template for transcription. The START CODON is AUG and the STOP CODON IS UAA. a) Draw the mRNA transcript that would be made from this DNA molecule. b) Translate the mRNA and show the amino acid sequence of the encoded protein. 5’-AGGTCCAGTCTTCGGCGGATGATCGGGTCAAACCCGGGGTAACTGGTCACCGGCATCC-3’ 3’-TCCAGGTCAGAAGCCGCCTACTAGCCCAGTTTGGGCCCCATTGACCAGTGGCCGTAGG-5’

  • Hello please please help !! Thank you!! Please and thank you soo much!!! Question Completion Status:...

    Hello please please help !! Thank you!! Please and thank you soo much!!! Question Completion Status: Question 10: The genetic code consists of 64 triplets of nucleotides (called codons). Each codon (with the exception of the 3 stop codons) encodes for one of the 20 amino acids used in the synthesis of proteins. This produces some redundancy in the code as most amino acids are encoded by more than one codon. One codon, AUG serves two related functions: it signals...

  • Question 2. FOR A BACTERIAL GENE, writing left-to-right, show the relative positions of each of these...

    Question 2. FOR A BACTERIAL GENE, writing left-to-right, show the relative positions of each of these genetic elements as they would appear in the DNA from upstream on the left to downstream on the right. Of course, some of these genetic elements will only be active once they are in mRNA (e.g., the translational start codon), but they are still found encoded in the sequence of DNA. RBS ribosome binding site UAA translational stop site (UAA) TSS transcriptional start site...

  • Question 9: The genetic code is read in groups of three nucleotides, called codons, in mRNA...

    Question 9: The genetic code is read in groups of three nucleotides, called codons, in mRNA that specifies for a particular amino acid. tRNA molecules act as the amino acid carriers that by correctly pairing with the codon on mRNA can deliver the correct amino acid to the ribosome during translation. At the tip of each tRNA molecule is a group of three nucleotides called an anticodon and at the other end is where the corresponding amino acid is attached...

  • 3. Translation. According to the rules of the genetic code, there are six different reading frames...

    3. Translation. According to the rules of the genetic code, there are six different reading frames in a double- stranded DNA molecule. One DNA strand serves as a template for transcription, which is complementary and antiparallel to the RNA product. The other DNA strand is the coding strand, which is identical in sequence to the RNA except for the substitution of uracil for thymine bases. A) There is a single open-reading frame (ORF) in the DNA molecule shown below. [Recall...

  • Fill in the complementary base pairs for the strand below STACGCCCATTI TAGA ATTGCGTGGGCATTAAGTTTTA TACC3 DNA sequences...

    Fill in the complementary base pairs for the strand below STACGCCCATTI TAGA ATTGCGTGGGCATTAAGTTTTA TACC3 DNA sequences 3' I Find and put a square around the TATA box (promoter) in the double stranded DNA above Find and circle the terminator sequence (GGGCG) in one of the strands above The strand with promoter and terminator is the strand of interest: using the template strand, synthesize an mRNA sequence mRNA molecule in the boxes below; pay attention to polarity 53: Find and circle...

  • 1. Label the template and coding strand. Label upstream and downstream ends.

    1. Label the template and coding strand. Label upstream and downstream ends.2. On the template strand identify the promoter.3. Identify the start site.4. Block off and number the triplets to be transcribed.5. Create the pre-mRNA. Label 5’ and 3’ ends.6. Using the codon table for mRNA (genetic dictionary), identify the start and stop codons.7. Identify the utrs (untranslated regions).8. Add a 5’ cap to the 5’ end of the mRNA transcript and a poly-A-tail to the 3’ end.9. Block off...

ADVERTISEMENT
Free Homework Help App
Download From Google Play
Scan Your Homework
to Get Instant Free Answers
Need Online Homework Help?
Ask a Question
Get Answers For Free
Most questions answered within 3 hours.
ADVERTISEMENT
ADVERTISEMENT
ADVERTISEMENT