Homework Answers
Answer
Following are the components of the bacterial gene in the correct order
-35-TATA- (-10)- TSS- RBS- AUG- CGU- UAA- (S-L)
promoter -( 35, TATA, -10)
Transcription start site ( ATG)
RBS( ribosome binding site in the Shine Dalgarno sequences)
Add Answer to:
Question 2. FOR A BACTERIAL GENE, writing left-to-right, show the relative positions of each of these...
1. EORA BACTERIAL GENE, writing left-to-right, show the relative positions of each of these genetic elements...
1. EORA BACTERIAL GENE, writing left-to-right, show the relative positions of each of these genetic elements as they would appear in the DNA from upstream on the left to downstream on the right. Of course, some of these genetic elements will only be active once they are in mRNA (e.g., the translational start codon), but they are still found encoded in the sequence of DNA onthe left the translational start colon . but they are s RBS ribosome binding site...
Uluruunu us RJ15 1. Draw or describe the process of eukaryotic transcription and translation, using the...
Uluruunu us RJ15 1. Draw or describe the process of eukaryotic transcription and translation, using the following terms as needed (not all terms will be used): sigma factor, RNA polymerase, DNA polymerase, origin of replication, ribosome, start codon, transcriptional start site, stop codon, nucleus, -10 and -35 sequences, TATA box, TBP, inducer, transcriptional stop site, Shine-Delgrano sequence, Kozak sequence, RNA splicing. 2. Draw or describe the process of prokaryotic/eubacterial transcription and translation, using as many of the terms above as...
The template strand of a given gene includes the sequence 3'-GCCACGTATCAG-5'. For each one, be sure...
The template strand of a given gene includes the sequence 3'-GCCACGTATCAG-5'. For each one, be sure to indicate 5' and 3' ends (DNA & RNA) and N and C termini (polypeptide). What is the sequence of the nontemplate strand (a), mRNA sequence made (b) and polypeptide made (c)? Hint: They are aligned in a way that you don't have to worry about the direction, because polynucleotides grow from 5' to 3' direction. (7 pts) Second base of RNA codon 000...
Below is the partial coding strand of DNA for a gene containing an ORF, shown 5'...
Below is the partial coding strand of DNA for a gene containing
an ORF, shown 5' to 3'. Identify the regions, shown 1 to 9,
associated with the following genetic elements. Some elements may
have more than one associated region.
(a) The promoter region
(b) The ribosome binding site
(c) The ribosome binding site consensus
sequence
(d) The start codon
(f) The expected region for the +1
transcription (where the transcript
begins to be made)
(g) Is this a prokaryotic...
Exam Practice Questions: L09-11 1. Fill in each blank with the best word or phrase selected...
Exam Practice Questions: L09-11 1. Fill in each blank with the best word or phrase selected from the list below. Not all words or phrases will be used; each word or phrase should be used only once. promoter translation pause site RBS sigma factor tmRNA RNA polymerase stop codon transcription Rho factor ribosome start codon DNA polymerase attenuation tRNA The first step in gene expression is by to make an mRNA that encodes for one or more proteins. This requires...
50 LAB 2 Genetics EXERCISE 10 PROTEIN SYNTHESIS Work with a partner to complete this exercise...
50 LAB 2 Genetics EXERCISE 10 PROTEIN SYNTHESIS Work with a partner to complete this exercise and answer the questions that follow. You will use the DNA strand from Exercise to make the protein for which it codes STEP 1 Review the imaginary strand of DNA below. Note the complementary base pairs. AGCAATCCGTCTTGG TCGTTAGG CAGAACC STEP 2 Draw the DNA strand separating down the middle las in the beginning of DNA replication STEP 3 Draw the free-floating RNA bases linking...
The sequence below represents an eukaryotic gene which underwent a mutation (maroon). The arrow displays the...
The sequence below represents an eukaryotic gene which underwent a mutation (maroon). The arrow displays the transcriptional start site, as discussed during the class. (a) What is the sequence of the RNA that is transcribed? Write the sequence as 5' to 3: 5'CAGTACTATCCAAGACATGGCGACA 3' 3' GTCATGATAGGTTATGTACCGCTGT 5' -3. The RNA sequence is: 5'- (b) Write the peptide sequence that will be translated (if any) when this gene gets transcriptionally active. Use the genetic code provided below, and write the sequence...
5' or or Using the codon table provided, fill in the missing entries in the following...
5' or or Using the codon table provided, fill in the missing entries in the following table (yellow boxes with numbers). Assume that the reading frame is fromleft to right(and the start codon is not SHOWN here, but EXISTS upstream [to the left] of the sequence shown here) and that columns represent transcriptional and translational alignments. 5. Strand ID? 3' 1 3 4 5 6 A T G | I | G | 15 16 7. 14 17 དུ་ U...
For A I need help identifying which row of sequence each of the features are located...
For A I need help identifying which row of sequence each of the
features are located on.
For B I need help understanding what would happen if the base
highlighted in the second row of sequence changed from "g" to
"a"
And for C I need help understanding what would occur if the base
highlighted in the first row of sequence changes from "a" to
"c"
The sequence of a simplified Eukaryotic protein-coding Rene region is shown below. The sequence...
The following DNA sequence contains a bacterial gene: 1. Copy the above sequence and indicate on...
The following DNA sequence contains a bacterial gene:
1. Copy the above sequence and indicate on
it the:
a. -10 and -35 promoter region
b. Ribosome binding site
c. Stop codon (and whether it is an amber, opal or ochre
codon),
d. Transcriptional terminator.
e. Note the atg start site has been marked and the gene is
indicated in italics
2. Is the promoter a strong or weak promoter? Why?
3. Is the terminator a Rho dependent or Rho independent...
1. EORA BACTERIAL GENE, writing left-to-right, show the relative positions of each of these genetic elements as they would appear in the DNA from upstream on the left to downstream on the right. Of course, some of these genetic elements will only be active once they are in mRNA (e.g., the translational start codon), but they are still found encoded in the sequence of DNA onthe left the translational start colon . but they are s RBS ribosome binding site...
Uluruunu us RJ15 1. Draw or describe the process of eukaryotic transcription and translation, using the following terms as needed (not all terms will be used): sigma factor, RNA polymerase, DNA polymerase, origin of replication, ribosome, start codon, transcriptional start site, stop codon, nucleus, -10 and -35 sequences, TATA box, TBP, inducer, transcriptional stop site, Shine-Delgrano sequence, Kozak sequence, RNA splicing. 2. Draw or describe the process of prokaryotic/eubacterial transcription and translation, using as many of the terms above as...
The template strand of a given gene includes the sequence 3'-GCCACGTATCAG-5'. For each one, be sure to indicate 5' and 3' ends (DNA & RNA) and N and C termini (polypeptide). What is the sequence of the nontemplate strand (a), mRNA sequence made (b) and polypeptide made (c)? Hint: They are aligned in a way that you don't have to worry about the direction, because polynucleotides grow from 5' to 3' direction. (7 pts) Second base of RNA codon 000...
Below is the partial coding strand of DNA for a gene containing
an ORF, shown 5' to 3'. Identify the regions, shown 1 to 9,
associated with the following genetic elements. Some elements may
have more than one associated region.
(a) The promoter region
(b) The ribosome binding site
(c) The ribosome binding site consensus
sequence
(d) The start codon
(f) The expected region for the +1
transcription (where the transcript
begins to be made)
(g) Is this a prokaryotic...
Exam Practice Questions: L09-11 1. Fill in each blank with the best word or phrase selected from the list below. Not all words or phrases will be used; each word or phrase should be used only once. promoter translation pause site RBS sigma factor tmRNA RNA polymerase stop codon transcription Rho factor ribosome start codon DNA polymerase attenuation tRNA The first step in gene expression is by to make an mRNA that encodes for one or more proteins. This requires...
50 LAB 2 Genetics EXERCISE 10 PROTEIN SYNTHESIS Work with a partner to complete this exercise and answer the questions that follow. You will use the DNA strand from Exercise to make the protein for which it codes STEP 1 Review the imaginary strand of DNA below. Note the complementary base pairs. AGCAATCCGTCTTGG TCGTTAGG CAGAACC STEP 2 Draw the DNA strand separating down the middle las in the beginning of DNA replication STEP 3 Draw the free-floating RNA bases linking...
The sequence below represents an eukaryotic gene which underwent a mutation (maroon). The arrow displays the transcriptional start site, as discussed during the class. (a) What is the sequence of the RNA that is transcribed? Write the sequence as 5' to 3: 5'CAGTACTATCCAAGACATGGCGACA 3' 3' GTCATGATAGGTTATGTACCGCTGT 5' -3. The RNA sequence is: 5'- (b) Write the peptide sequence that will be translated (if any) when this gene gets transcriptionally active. Use the genetic code provided below, and write the sequence...
5' or or Using the codon table provided, fill in the missing entries in the following table (yellow boxes with numbers). Assume that the reading frame is fromleft to right(and the start codon is not SHOWN here, but EXISTS upstream [to the left] of the sequence shown here) and that columns represent transcriptional and translational alignments. 5. Strand ID? 3' 1 3 4 5 6 A T G | I | G | 15 16 7. 14 17 དུ་ U...
For A I need help identifying which row of sequence each of the
features are located on.
For B I need help understanding what would happen if the base
highlighted in the second row of sequence changed from "g" to
"a"
And for C I need help understanding what would occur if the base
highlighted in the first row of sequence changes from "a" to
"c"
The sequence of a simplified Eukaryotic protein-coding Rene region is shown below. The sequence...
The following DNA sequence contains a bacterial gene:
1. Copy the above sequence and indicate on
it the:
a. -10 and -35 promoter region
b. Ribosome binding site
c. Stop codon (and whether it is an amber, opal or ochre
codon),
d. Transcriptional terminator.
e. Note the atg start site has been marked and the gene is
indicated in italics
2. Is the promoter a strong or weak promoter? Why?
3. Is the terminator a Rho dependent or Rho independent...
Most questions answered within 3 hours.
-
Discuss the impact of technology on Medieval society and culture
and the impact of society and...
asked 6 seconds ago -
2. Content theories attempt to explain work behaviors based on
__________.
a. the relationship between values...
asked 3 minutes ago -
function predictKNN which computes the KNN prediction for given
input xi, K and train data.
A...
asked 4 minutes ago -
A scientist randomly mutates the DNA of a bacterium. She then
sequences the bacterium’s daughter cells,...
asked 10 minutes ago -
A 3.15-g bullet embeds itself in a 1.17-kg block, which is
attached to a spring of...
asked 18 minutes ago -
A hawk is flying horizontally at 24.0 m/s in a straight line,
185 m above the...
asked 19 minutes ago -
Draw a Supply and Demand Graph for yourself. Now draw a dashed
line vertically down through...
asked 16 minutes ago -
1a. An aqueous solution of calcium hydroxide is
standardized by titration with a 0.116 M solution...
asked 21 minutes ago -
In response to concerns about nutritional contents of fast
foods, McDonald's has announced that it will...
asked 37 minutes ago -
A gun with inertia 5.5 kg fires a 13-g bullet at a stationary
target located 1.0...
asked 39 minutes ago -
A box contains twenty-five screws which are identical in size,
but 13 of which are copper...
asked 41 minutes ago -
“Is it possible that objectively
a product is high quality but subjectively low
quality?”
Please support...
asked 43 minutes ago