Question

The sequence of a simplified Eukaryotic protein-coding Rene region is shown below. The sequence includes some of the sequence upstream of the gene, the transcribed region (including an intron - shown with lower case letters), and downstream sequence. For your convenience, the sequence has been numbered so you can more easily identify positions. For example, position 170 (shown in bold) can be found by going to the row starting with 151, then going right to the 19th column (151 + 19 = 170). 1: 00000000001111111111222222222233333333334444444444 01234567890123456789012345678901234567890123456789 AGCCCATCCCTTATAAATTAGCGAACGAGTCACGACTTACTTGCTGAAAA :50 51: TATGAACCACGCAAGCGCTTCTGCCGCCGGCGAGCACTCTGgtaatagac :100 101: cgcccctctcatctctttgctcatccttcagGTAGGAAGCGCCTGTCCT :150 151: TCTTCGTGGCCGTGCCCGCCGTGGGACTGTGCATGCTGAACGCCTACCTG:200 201: AAGCACCAGGGCCACGCTACGAGCACTAGTTAGTTGTCAACCCAGCAAAT :250 251: TTTCATTGCGCTTCAATAAAGATCAA- 00000000001111111111222222222233333333334444444444 01234567890123456789012345678901234567890123456789 -- :300 a. Identify the following features of the gene by position and sequence. You can circle and annotate, or use color highlighting in word/docs. 1. The "TATA" box, the transcription start site, and the polyadenylation site. 2. The Translation start and stop site (start and stop codon). Remember, a stop codon is ONLY USED if it is translated "in-frame" with the start codon. 3. The 5' UTR and 3' UTR b. In your own words, describe what would occur if the base highlighted at position 92 changed from a “g” to an "a" c. In your own words, describe what would occur if the base highlighted at position 13 changed from an "A" to a "C"

For A I need help identifying which row of sequence each of the features are located on.

For B I need help understanding what would happen if the base highlighted in the second row of sequence changed from "g" to "a"

And for C I need help understanding what would occur if the base highlighted in the first row of sequence changes from "a" to "c"

Answer 1

A. 1. TATA box and transcription start site are located in the first row. Polyadenylation site is located at the last row.

2. Start codon in DNA is TAC (position 38 39 40) located at first row. Stop codon is located at 2nd row (TGA nt position 53 54 55)

3 5' UTR is located in first row and 3' UTR is located on 2nd row

B. Base position 92 is located at exon intron boundary. Exon intron boundary is very much important for excision of intron by spliceosomes. So, if any mutation occur at position 92, the intron will not be spliced.

C. Position 13 , the A is part of TATA box. So if there is C in place of A at the 13th position, RNA polymerase recognize TATA box and starts transcription. So any mutation at the TATA box will affect transcription.