Question

Below is the partial coding strand of DNA for a gene containing an ORF, shown 5' to 3'. Identify the regions, shown 1 to 9, associated with the following genetic elements. Some elements may have more than one associated region.

(a) The promoter region

(b) The ribosome binding site

(c) The ribosome binding site consensus sequence

(d) The start codon

(f) The expected region for the +1 transcription (where the transcript begins to be made)

(g) Is this a prokaryotic or eukaryotic gene? Give 2 pieces of evidence that support your answer.

3 -35 -10 AGCTTGACA7GCGGTGTACCGTCATTATAATCGCCATCTCAGTGTGCAAGGAGG 6 ACTUACGATGCCGCTGGACGCCTGTTATATTGAGATCGCTGATCGATCTAGGC GGCTGGATGCCCTCTCGATCTGATGCTTAGCAGGATGTACCGTCGTTTTTCGA

Answer 1

Coding strand of DNA has the same sequence as the mRNA except T of DNA is replaced by U in mRNA.

1. Promoter region: It is shown by 1 along with region 2. Promoter region is located upstream of the DNA on the 5’ end of the coding strand. It encompasses from -35 region to +1. At -35 it has -35 box which has consensus sequence TTGACA, and at -10 it has -10 box which has consensus sequence TATAAT.
2. Ribosome binding site: It is shown by 4. As ribosome binds 3-10 nucleotides up the start codon AUG on mRNA.
3. Ribosome binding site consensus sequence: It is shown by 4. This sequence 5’ AGGAGG 3’ on the mRNA. On DNA coding strand it is 5’ AGGAGG3’.
4. The start codon : is present in region 5. Start codon is 5’ AUG 3’ on mRNA. It is 5’ ATG 3’ on DNA coding strand.
5. The expected region for +1 transcription is in region 3 after the TATAAT box.
6. It is a prokaryotic gene because it has TATA box at -10 with sequence TATAAT and shine delgarno sequence 5’ AGGAGG 3’.