1. Explain the difference between spontaneous and induced mutations. Give an example of how each might...
1. Explain the difference between spontaneous and induced mutations. Give an example of how each might be caused
2. For the double stranded DNA molecule shown below, the BOTTOM
strand is the template for transcription. The START CODON is AUG
and the STOP CODON IS UAA.
a) Draw the mRNA transcript that would be made from this DNA
molecule.
b) Translate the mRNA and show the amino acid sequence of the
encoded protein.
5’-AGGTCCAGTCTTCGGCGGATGATCGGGTCAAACCCGGGGTAACTGGTCACCGGCATCC-3’
3’-TCCAGGTCAGAAGCCGCCTACTAGCCCAGTTTGGGCCCCATTGACCAGTGGCCGTAGG-5’
Homework Answers
1. Explain the difference between spontaneous and induced mutations. Give an example of how each might be caused.
Spontaneous mutation is caused by errors in natural biological processes, whereas induced mutations are mainly man-made and caused by environmental agents.
Spontaneous mutation occurs naturally without human interference. Examples include point mutation.
Induced mutations are set in force by human motivation. People induce mutations via various means like radiation or chemical mutagens.
2. a) Draw the mRNA transcript that would be made from this DNA molecule.
5’-AGGUCCAGUCUUCGGCGGAUGAUCGGGUCAAACCCGGGGUAACUGGUCACCGGCAUCC-3’
b) Translate the mRNA and show the amino acid sequence of the encoded protein.
5'-AUG-AUC-GGG-UCA-AAC-CCG-GGG-UAA-3'
Met-Ile-Gly-Ser-Asn-Pro-Gly
Add Answer to:
1. Explain the difference between spontaneous and induced
mutations. Give an example of how each might...
1.) In which direction is RNA transcribed? 2.) Which of the two strands (A or...
1.) In which direction is RNA transcribed?
2.) Which of the two strands (A or B) serves as the TEMPLATE
strand for the transcription of a mRNA that contains both a start
and a stop codon?
3.) Which number (1, 2, 3, 4, or 5) best approximates the
location of the -10 consensus sequence?
4.) How many amino acids long is the protein encoded by the mRNA
from this DNA sequence?
5.) What is the second...
3. Translation. According to the rules of the genetic code, there are six different reading frames...
3. Translation. According to the rules of the genetic code, there are six different reading frames in a double- stranded DNA molecule. One DNA strand serves as a template for transcription, which is complementary and antiparallel to the RNA product. The other DNA strand is the coding strand, which is identical in sequence to the RNA except for the substitution of uracil for thymine bases. A) There is a single open-reading frame (ORF) in the DNA molecule shown below. [Recall...
Fill in the complementary base pairs for the strand below STACGCCCATTI TAGA ATTGCGTGGGCATTAAGTTTTA TACC3 DNA sequences...
Fill in the complementary base pairs for the strand below STACGCCCATTI TAGA ATTGCGTGGGCATTAAGTTTTA TACC3 DNA sequences 3' I Find and put a square around the TATA box (promoter) in the double stranded DNA above Find and circle the terminator sequence (GGGCG) in one of the strands above The strand with promoter and terminator is the strand of interest: using the template strand, synthesize an mRNA sequence mRNA molecule in the boxes below; pay attention to polarity 53: Find and circle...
6. A double-stranded DNA molecule with the sequence shown here produces a polypeptide that is 5...
6. A double-stranded DNA molecule with the sequence shown here produces a polypeptide that is 5 amino acids long. The sequence does not include the promoter. Transcription is proceeding left to right(). thlt TEAM 3' ATGradGGCTAAAGTGCCATCTAAAGATCGTACAT 5' loding 5' TACATGCCGATTTCACGCTAGATTTCTAGCATGTA 3' shar a. Label the template and coding strands. b. In the template strand, underline the nucleotides that will encode the start codon. c. The stop codon for the polypeptide is (UAA (UAG UGA).(circle the correct answer) d. In the...
Use the Mutations interactive to determine which statements describe silent mutations. The adenine of the start...
Use the Mutations interactive
to determine which statements describe silent mutations. The
adenine of the start codon is position +1.
a substitution from G to T in the arginine codon of the
antisense stand
a substitution of a G nucleotide at position +9 in the antisense
strand
a transition at position +6 in the sense strand
a transversion of A in the histidine codon of the antisense
strand
a single nucleotide deletion at position +12 in the antisense
strand
a...
The following is a fragment of double stranded DNA . The bottom strand is the template...
The following is a fragment of double stranded DNA . The bottom strand is the template strand. It encodes a hypothetical 6 amino protein & includes the start (initiator) codon, a small amount of 5’ UTR, and a small amount of 3’ UTR TTGGCAATGTGATCCCTTGTGCGGTACCACT AACCGTTACACTAGGGAACACGCCATGGTGA (Template strand) The bottom strand is the template strand and the RNA polymerase will always move from right-to-left, this is the direction of RNA synthesis RNA transcript compares to the non-template strand by being exactly...
The following is a fragment of double-stranded DNA. It encodes a hypothetical 6 amino acid protein...
The following is a fragment of double-stranded DNA. It encodes a hypothetical 6 amino acid protein and includes the start (initiator) codon, a small amount of 5' UTR, and a small amount of 3' UTR. TTGGCAATGTGATCCCTTGTGCGGTACCACT AACCGTTACACTAGGGAACACGCCATGGTGA The bottom strand is the template, and the RNA polymerase moves along the bottom (template) strand from RIGHT TO LEFT. a) Determine the orientation of the DNA template. The template strand is copied below. (Enter either 5' or 3' in the box below,...
Hemoglobin is a protein that is found in red blood cells. It binds to oxygen in...
Hemoglobin is a protein that is found in red blood cells. It binds to oxygen in the lungs and it carries it to tissues and cells throughout the body. Hemoglobin is made of four polypeptide chains, two called “alpha-globins” (a) and two “beta-globins" (B). The B-globin polypeptide is produced in the cells based on the sequence of the HBB gene. The structure of the HBB gene that codes for beta-globin is represented below. The primary transcript is 1606 nucleotides long....
I have my own answers, i just want to check my work, thanks! Given the DNA...
I have my own answers, i just want to check my work,
thanks!
Given the DNA sequence below: 3'-CGTCCTTCTATACTTCGCGGAATGCCGGTCCATGTAGGTTCACATTAGCGT-5' (Coding strand) 1. Replicate the corresponding template strand by using the aforementioned coding strand. Label the 5' and 3' ends in the new strand. 2. Transcribe the template strand to an mRNA sequence. 3. Find the start and stop codons on the mRNA and enclose it in a box or label with different color. 4. Write the amino acid sequence of...
Please answer only if you know how to!!! Please follow the directions and label clearly! On...
Please answer only if you know how to!!!
Please follow the directions and label
clearly!
On the next page is a small segment of DNA that includes one gene. The list below contains all th e information that must be encoded in that gene in order for both transcription and translation to occur correctly 1. On the DNA, LABEL the location of every item on the list. Hint: some locations will be approximate 2. In the space provided below the...
1.) In which direction is RNA transcribed?
2.) Which of the two strands (A or B) serves as the TEMPLATE
strand for the transcription of a mRNA that contains both a start
and a stop codon?
3.) Which number (1, 2, 3, 4, or 5) best approximates the
location of the -10 consensus sequence?
4.) How many amino acids long is the protein encoded by the mRNA
from this DNA sequence?
5.) What is the second...
3. Translation. According to the rules of the genetic code, there are six different reading frames in a double- stranded DNA molecule. One DNA strand serves as a template for transcription, which is complementary and antiparallel to the RNA product. The other DNA strand is the coding strand, which is identical in sequence to the RNA except for the substitution of uracil for thymine bases. A) There is a single open-reading frame (ORF) in the DNA molecule shown below. [Recall...
Fill in the complementary base pairs for the strand below STACGCCCATTI TAGA ATTGCGTGGGCATTAAGTTTTA TACC3 DNA sequences 3' I Find and put a square around the TATA box (promoter) in the double stranded DNA above Find and circle the terminator sequence (GGGCG) in one of the strands above The strand with promoter and terminator is the strand of interest: using the template strand, synthesize an mRNA sequence mRNA molecule in the boxes below; pay attention to polarity 53: Find and circle...
6. A double-stranded DNA molecule with the sequence shown here produces a polypeptide that is 5 amino acids long. The sequence does not include the promoter. Transcription is proceeding left to right(). thlt TEAM 3' ATGradGGCTAAAGTGCCATCTAAAGATCGTACAT 5' loding 5' TACATGCCGATTTCACGCTAGATTTCTAGCATGTA 3' shar a. Label the template and coding strands. b. In the template strand, underline the nucleotides that will encode the start codon. c. The stop codon for the polypeptide is (UAA (UAG UGA).(circle the correct answer) d. In the...
Use the Mutations interactive
to determine which statements describe silent mutations. The
adenine of the start codon is position +1.
a substitution from G to T in the arginine codon of the
antisense stand
a substitution of a G nucleotide at position +9 in the antisense
strand
a transition at position +6 in the sense strand
a transversion of A in the histidine codon of the antisense
strand
a single nucleotide deletion at position +12 in the antisense
strand
a...
The following is a fragment of double-stranded DNA. It encodes a hypothetical 6 amino acid protein and includes the start (initiator) codon, a small amount of 5' UTR, and a small amount of 3' UTR. TTGGCAATGTGATCCCTTGTGCGGTACCACT AACCGTTACACTAGGGAACACGCCATGGTGA The bottom strand is the template, and the RNA polymerase moves along the bottom (template) strand from RIGHT TO LEFT. a) Determine the orientation of the DNA template. The template strand is copied below. (Enter either 5' or 3' in the box below,...
Hemoglobin is a protein that is found in red blood cells. It binds to oxygen in the lungs and it carries it to tissues and cells throughout the body. Hemoglobin is made of four polypeptide chains, two called “alpha-globins” (a) and two “beta-globins" (B). The B-globin polypeptide is produced in the cells based on the sequence of the HBB gene. The structure of the HBB gene that codes for beta-globin is represented below. The primary transcript is 1606 nucleotides long....
I have my own answers, i just want to check my work,
thanks!
Given the DNA sequence below: 3'-CGTCCTTCTATACTTCGCGGAATGCCGGTCCATGTAGGTTCACATTAGCGT-5' (Coding strand) 1. Replicate the corresponding template strand by using the aforementioned coding strand. Label the 5' and 3' ends in the new strand. 2. Transcribe the template strand to an mRNA sequence. 3. Find the start and stop codons on the mRNA and enclose it in a box or label with different color. 4. Write the amino acid sequence of...
Please answer only if you know how to!!!
Please follow the directions and label
clearly!
On the next page is a small segment of DNA that includes one gene. The list below contains all th e information that must be encoded in that gene in order for both transcription and translation to occur correctly 1. On the DNA, LABEL the location of every item on the list. Hint: some locations will be approximate 2. In the space provided below the...
Most questions answered within 3 hours.
-
What is the source of information from natural materials which
can be used to reconstruct climate...
asked 1 minute ago -
The International Monetary Fund (IMF) has hired you as an
economist. Your assignment is to travel...
asked 5 minutes ago -
Brief Exercise 12-65
Profitability Ratios
Tinker Corporation operates in the highly competitive consulting
industry. Tinker's balance...
asked 31 minutes ago -
Consider Lewin's three-step process. Which of the three steps do
you thin would be hardest to...
asked 30 minutes ago -
A disabled tanker leaks kerosene (n = 1.20) into the
Persian Gulf, creating a large slick...
asked 44 minutes ago -
5. Explain the condition for a DC motor to develop the
maximum power. If a DC...
asked 59 minutes ago -
Compute the p[Ag] after 35.00 mL of 0.1 M silver nitrate has been
added to the...
asked 1 hour ago -
Walgreen Company (NYSE: WAG) is currently trading at $48.50 on
the NYSE. Walgreen Company is also...
asked 1 hour ago -
Based on historical data, your team knows what proportion of the
company's orders come from Males...
asked 1 hour ago -
8. Which of the following atoms has the largest magnitude
electron affinity?
(a) Sodium (Na)
(b)...
asked 1 hour ago -
Assess the two types of tests of cognitive abilities. (
regarding HR course)
asked 1 hour ago -
1.Write an inspiring vision statement for an organization where
you work or have worked. If the...
asked 1 hour ago