Homework Answers
In Escherichia coli genome, Arginine is most likely coded by codons with the highest G+C content. This is because from the given table, we can clearly see that the percentage usage of the codons CGA, CGC, CGG and CGU for Arginine is much more than the genomes of Human and Fruit-fly.
Add Answer to:
The table below shows the codon usage for Arginine in THREE (3) genomes: human, fruitfly and...
Translation: find the start codon AUG on the mRNA below, underline nucleotides in sets of three...
Translation: find the start codon AUG on the mRNA below, underline nucleotides in sets of three (codons), find the appropriate amino acid for each codon in the chart below, and stop when you come to a stop codon. Translate the following mRNA. AACACCAUGACCUACAUAGGGAGGGACUUAGUAGCGGAGGGGUGAUCAUUA The genetic code UUU phenylalanine UCU serine UAU tyrosine UGU cysteine UUC phenylalanine UCC serine UAC tyrosine UGC cysteine UUA leucine UCA serine UAA STOP UGA STOP UUG leucine UCG serine UAG STOP UGG tryptophan CUU leucine...
Use the genetic code table to answer the following question: Second Base First Base Third Base...
Use the genetic code table to answer the following question: Second Base First Base Third Base UUU UUC Phenylalanine U UCU UAC UCA UCG Serine UUA UUG Leucine UAU UGU UAC Tyrosine UGC Cysteine UAA Stop codon UGA Stop codon UAG Stop codon UGG Tryptophan CAU CGU Histidine CAC CGC Arginine CAG Glutamine CGG CUU CUC CUA CUG Leucine CCU CCC CCA CCG Proline CAA CGA AUU AAU Asparagine AGU Serine AGC AUC AUA Isolaucine ACU ACC ACA ACG AAC...
If mutations occur at random, and changes to 1st or 2nd "letter" of a codon usually...
If mutations occur at random, and changes to 1st or 2nd "letter" of a codon usually changes the amino acid coded for, but changes to the 3rd "letter" rarely do, roughly what % of mutations should be synonymous? Second АТ G UUU Phe UCU Ser UAU Tyr UGU Cys U 0 C | Phe UCC Ser UAC Tyr UGC Cys C Leu UCA Ser UAA Stop UGA Stop UUG Leu UCG Ser UAG Stop UGG Trp G CUU Leu CCU...
5' or or Using the codon table provided, fill in the missing entries in the following...
5' or or Using the codon table provided, fill in the missing entries in the following table (yellow boxes with numbers). Assume that the reading frame is fromleft to right(and the start codon is not SHOWN here, but EXISTS upstream [to the left] of the sequence shown here) and that columns represent transcriptional and translational alignments. 5. Strand ID? 3' 1 3 4 5 6 A T G | I | G | 15 16 7. 14 17 དུ་ U...
A small portion of the human transport protein amino acid sequence is shown below. The upper...
A small portion of the human transport protein amino acid sequence is shown below. The upper sequence is associated with darker skin, and the lower sequence is associated with lighter skin. What DNA base-pair change created the light-skin form of the human protein from the gene that coded for the dark-skir form? Ala-Gly Ala ThrPhe Ala Gly-Thr-Thr - Phe SECOND BASE SUAU TI Phe TUUU UUC UUA UUG] TUCU UCC UCA UCG Ser (UAC LUGU) UGC UAA Stop UAG Stop...
i think it might be Glutamate, but im not sure. Someone please help!! its the last...
i think it might be Glutamate, but im not sure.
Someone please help!! its the last question i need to
finish this mindtap.
please respond quickly too, its due TODAY at 11:59pm
EST
CENGAGE MINDTAP a se Chapter 9 Digging Deeper Conceptual Learning Activity Second base U C A G UUU Phenylalanine UCU UUC Phenylalanine UCC Leucine UCA Leucine UCG Leucine CCU Leucine CCC Leucine CCA Leucine CCG Isoleucine ACU Isoleucine ACC Isoleucine ACA Methionine ACG Cysteine U Cysteine C...
UUU Phe UGA UCAS UAG CAU : CUCI First base (5' end) Table 1. The Genetic...
UUU Phe UGA UCAS UAG CAU : CUCI First base (5' end) Table 1. The Genetic Code for All 20 Amino Acids Second base -A- -G- UCU LAUT UGU UUC (phenylalanin UCCI UAC ) UGCysteine) UUA. serine UAA UUGI (cine) UGG Try tryptophan) CUU CGU CAC hidÌ CGC Ang CAA in CGA Carpinine) CAG plutamine) CGG AUU AAU 1 An AUC (isoleucine) AAC pengine AGC serie) AAA1 Lys AUG MOM AAG sind) AGGI arginine) GCU GAUl Asp GGU GUC Val...
50 LAB 2 Genetics EXERCISE 10 PROTEIN SYNTHESIS Work with a partner to complete this exercise...
50 LAB 2 Genetics EXERCISE 10 PROTEIN SYNTHESIS Work with a partner to complete this exercise and answer the questions that follow. You will use the DNA strand from Exercise to make the protein for which it codes STEP 1 Review the imaginary strand of DNA below. Note the complementary base pairs. AGCAATCCGTCTTGG TCGTTAGG CAGAACC STEP 2 Draw the DNA strand separating down the middle las in the beginning of DNA replication STEP 3 Draw the free-floating RNA bases linking...
mestion 2 of 15 > Consider the sequencing chromatograms of the four variants of the alpha...
mestion 2 of 15 > Consider the sequencing chromatograms of the four variants of the alpha chain of human hemoglobin. Normal Karachi Chongqing Swan River ddATP ddCTP ATD about us Careers privacy policy terms of use contact us help ddATP ddCTP ddGTP ddTTP You can use the codon table to decode each amino acid sequence. For example, the first triplet in each sequencing chromatogram is GTG, which encodes for Val. What is the nature of the amino acid change in...
can you answer those 3 questions Ipuints Save an You have developed a potential new antidepressant...
can you answer those 3 questions
Ipuints Save an You have developed a potential new antidepressant drug called Euphoria. The structure is novel and is tested using the Ames test for mutagenicity. The following results are obtained: Sample Number of his+ revertant colonies distilled water distilled water + rat liver enzymes antidepressant antidepressant + rat liver enzymes What conclusion is most consistent with these data? the drug and its conversion products are not mutagenic. rat liver enzymes are mutagenic. the...
Use the genetic code table to answer the following question: Second Base First Base Third Base UUU UUC Phenylalanine U UCU UAC UCA UCG Serine UUA UUG Leucine UAU UGU UAC Tyrosine UGC Cysteine UAA Stop codon UGA Stop codon UAG Stop codon UGG Tryptophan CAU CGU Histidine CAC CGC Arginine CAG Glutamine CGG CUU CUC CUA CUG Leucine CCU CCC CCA CCG Proline CAA CGA AUU AAU Asparagine AGU Serine AGC AUC AUA Isolaucine ACU ACC ACA ACG AAC...
If mutations occur at random, and changes to 1st or 2nd "letter" of a codon usually changes the amino acid coded for, but changes to the 3rd "letter" rarely do, roughly what % of mutations should be synonymous? Second АТ G UUU Phe UCU Ser UAU Tyr UGU Cys U 0 C | Phe UCC Ser UAC Tyr UGC Cys C Leu UCA Ser UAA Stop UGA Stop UUG Leu UCG Ser UAG Stop UGG Trp G CUU Leu CCU...
5' or or Using the codon table provided, fill in the missing entries in the following table (yellow boxes with numbers). Assume that the reading frame is fromleft to right(and the start codon is not SHOWN here, but EXISTS upstream [to the left] of the sequence shown here) and that columns represent transcriptional and translational alignments. 5. Strand ID? 3' 1 3 4 5 6 A T G | I | G | 15 16 7. 14 17 དུ་ U...
A small portion of the human transport protein amino acid sequence is shown below. The upper sequence is associated with darker skin, and the lower sequence is associated with lighter skin. What DNA base-pair change created the light-skin form of the human protein from the gene that coded for the dark-skir form? Ala-Gly Ala ThrPhe Ala Gly-Thr-Thr - Phe SECOND BASE SUAU TI Phe TUUU UUC UUA UUG] TUCU UCC UCA UCG Ser (UAC LUGU) UGC UAA Stop UAG Stop...
i think it might be Glutamate, but im not sure.
Someone please help!! its the last question i need to
finish this mindtap.
please respond quickly too, its due TODAY at 11:59pm
EST
CENGAGE MINDTAP a se Chapter 9 Digging Deeper Conceptual Learning Activity Second base U C A G UUU Phenylalanine UCU UUC Phenylalanine UCC Leucine UCA Leucine UCG Leucine CCU Leucine CCC Leucine CCA Leucine CCG Isoleucine ACU Isoleucine ACC Isoleucine ACA Methionine ACG Cysteine U Cysteine C...
UUU Phe UGA UCAS UAG CAU : CUCI First base (5' end) Table 1. The Genetic Code for All 20 Amino Acids Second base -A- -G- UCU LAUT UGU UUC (phenylalanin UCCI UAC ) UGCysteine) UUA. serine UAA UUGI (cine) UGG Try tryptophan) CUU CGU CAC hidÌ CGC Ang CAA in CGA Carpinine) CAG plutamine) CGG AUU AAU 1 An AUC (isoleucine) AAC pengine AGC serie) AAA1 Lys AUG MOM AAG sind) AGGI arginine) GCU GAUl Asp GGU GUC Val...
50 LAB 2 Genetics EXERCISE 10 PROTEIN SYNTHESIS Work with a partner to complete this exercise and answer the questions that follow. You will use the DNA strand from Exercise to make the protein for which it codes STEP 1 Review the imaginary strand of DNA below. Note the complementary base pairs. AGCAATCCGTCTTGG TCGTTAGG CAGAACC STEP 2 Draw the DNA strand separating down the middle las in the beginning of DNA replication STEP 3 Draw the free-floating RNA bases linking...
mestion 2 of 15 > Consider the sequencing chromatograms of the four variants of the alpha chain of human hemoglobin. Normal Karachi Chongqing Swan River ddATP ddCTP ATD about us Careers privacy policy terms of use contact us help ddATP ddCTP ddGTP ddTTP You can use the codon table to decode each amino acid sequence. For example, the first triplet in each sequencing chromatogram is GTG, which encodes for Val. What is the nature of the amino acid change in...
can you answer those 3 questions
Ipuints Save an You have developed a potential new antidepressant drug called Euphoria. The structure is novel and is tested using the Ames test for mutagenicity. The following results are obtained: Sample Number of his+ revertant colonies distilled water distilled water + rat liver enzymes antidepressant antidepressant + rat liver enzymes What conclusion is most consistent with these data? the drug and its conversion products are not mutagenic. rat liver enzymes are mutagenic. the...
Most questions answered within 3 hours.
-
The mean waiting time at the drive-through of a fast-food
restaurant from the time an order...
asked 9 minutes ago -
The pitch (p) of a helix is defined as p = dn, in which n is...
asked 11 minutes ago -
Do you agree that the declining stock of social capital is the
blame for the failure...
asked 15 minutes ago -
A researcher is interested in whether coffee consumption helps
with performance on reading comprehension tasks. The...
asked 25 minutes ago -
it has been estimated since the beginning of the human race that
about 133 metric ton...
asked 30 minutes ago -
Where must Medicare prescription drug plans allow for
participants to fill their prescriptions?
asked 33 minutes ago -
Five moles of monatomic ideal gas have initial pressure 2.50 ×
103 Pa and initial volume...
asked 48 minutes ago -
A resistor and the capacitor are used to control the timing in
the RC circuit of...
asked 48 minutes ago -
Living in a group could bring several disadvantages to an
individual. What are some of the...
asked 1 hour ago -
Complete and balance the following reactions. In case of no
reaction occurring write NR.
Mix #1:...
asked 1 hour ago -
If an economy consumes 75% of any increase in income, then an
increase in autonomous investment...
asked 1 hour ago -
A shotputter throws the shot with an initial speed of 15.8 m/s
at a 38.0 ∘...
asked 1 hour ago