Homework Answers
Add Answer to:
20) Draw the sequence of amino acids in the following tetrapeptide: HENCH NHCH NHCH NHCH CH2OH...
Table 1: Partial RPE65 protein sequence (amino acids 41-60) for the 9-year-old LCA patient. Unmutated Protein...
Table 1: Partial RPE65 protein sequence (amino acids 41-60) for the 9-year-old LCA patient. Unmutated Protein Sequence Patient's Allele 1 Protein Sequence Patient's Allele 2 Protein Sequence START...Ser-Leu-Leu-Arg-Cyc-Gly-Pro-Gly-Leu-Phe-Glu-Val-Gly-Ser-Glu-Pro-Phe-Tyr- His-Gly...STOP START...Ser-Leu-Leu-Gin-Cyc-Gly-Pro-Gly-Leu-Phe-Glu-Val-Gly-Ser-Glu-Pro-Phe-Tyr- His-Gly...STOP START...Ser-Leu-Leu-Gin-Cyc-Gly-Pro-Gly-Leu-Phe-Glu-Val-Gly-Ser-Glu-Pro-Phe-Tyr- His-Gly...STOP Table 2. Partial RPE65 protein sequence (amino acids 61-70 and 291–300) for the 11-year-old LCA patient. Unmutated Protein Sequence Patient's Allele 1 Protein Sequence Patient's Allele 2 Protein Sequence START...Phe-Asp-Gly-Gln-Ala-Leu-Leu-His-Lys-Phe...lle-Ala-Asp-Lys-Lys-Arg-Lys-Lys- Tyr-Leu...STOP START...Phe-Asp-Gly-Gln-Ala-Leu-Leu-Tyr-Lys-Phe...lle-Ala-Asp-Lys-Lys-Arg-Lys-Lys- Tyr-Leu...STOP START...Phe-Asp-Gly-Gln-Ala-Leu-Leu-His-Lys-Phe...lle-Ala-Asp-Lys-STOP Source: Data from Russell et al. (2017). Use Tables 1 and 2 to...
Table 1: Partial RPE65 protein sequence (amino acids 41-60) for the 9-year-old LCA patient. Unmutated Protein...
Table 1: Partial RPE65 protein sequence (amino acids 41-60) for the 9-year-old LCA patient. Unmutated Protein Sequence Patient's Allele 1 Protein Sequence Patient's Allele 2 Protein Sequence START...Ser-Leu-Leu-Arg-Cyc-Gly-Pro-Gly-Leu-Phe-Glu-Val-Gly-Ser-Glu-Pro-Phe-Tyr- His-Gly...STOP START...Ser-Leu-Leu-Gin-Cyc-Gly-Pro-Gly-Leu-Phe-Glu-Val-Gly-Ser-Glu-Pro-Phe-Tyr- His-Gly...STOP START...Ser-Leu-Leu-Gin-Cyc-Gly-Pro-Gly-Leu-Phe-Glu-Val-Gly-Ser-Glu-Pro-Phe-Tyr- His-Gly...STOP Table 2. Partial RPE65 protein sequence (amino acids 61-70 and 291-300) for the 11-year-old LCA patient. Unmutated Protein Sequence Patient's Allele 1 Protein Sequence Patient's Allele 2 Protein Sequence START...Phe-Asp-Gly-Gln-Ala-Leu-Leu-His-Lys-Phe...lle-Ala-Asp-Lys-Lys-Arg-Lys-Lys- Tyr-Leu...STOP START...Phe-Asp-Gly-In-Ala-Leu-Leu-Tyr-Lys-Phe...Ile-Ala-Asp-Lys-Lys-Arg-Lys-Lys- Tyr-Leu...STOP START...Phe-Asp-Gly-Gln-Ala-Leu-Leu-His-Lys-Phe...lle-Ala-Asp-Lys-STOP Source: Data from Russell et al. (2017). Use Tables 1 and 2 to...
Which amino acids comprise the binding site for PGE A 601?
For 4F5S in RCSB PDB websiteWhich amino acids comprise the binding site for PGE A 601? Select all that apply ValAspTrplleSerGlyPheHisProLeuLysCysAlaAsnMetTyrThreGurArgGin
What amino acid would the Manticodon code for RNA codon table 2nd position Tot position СТА...
What amino acid would the Manticodon code for RNA codon table 2nd position Tot position СТА Tyr Phe Phe > eu eu Oulaa Jooo 9999 stop stop eu eu eu Let 0 - puchbucobucusura BER < Val Val Asp Ala Asp Ala Glu Ala Glu Amino Acids Keu Pro Pro His Weu Leu Gin lle Pro Thr Thr Thr Thr Asn Asn lle Ser Ser Arg lle Met Lys Lys bucoucouco Arg > Asp Asp Val Val Val Val Ala...
This sequence is RNA because:
20. This sequence is RNA because:A) it is single stranded.B) it contains U (uracil) and no T (thymine).C) it runs in a 5' to 3' direction.D) it codes for amino acids.E) it is a small molecule.21. Which amino acids does this sequence code for, if the reading frame is as shown, starting from the correct end? A) gly-ala-arg-cys-ile...B) pro-arg-ala-thr-stopC) met-asn-glu-leu...D) glu-leu-val-val-phe...E) leu-glu-gln-his-asn...22. If the sequence gets changed to 5' ... GGAGACUCGUUGUAUU... 3'. What would be the effect on the amino...
Question 10 (15 points) Given the following sequence for a template strand of DNA 3 -...
Question 10 (15 points) Given the following sequence for a template strand of DNA 3 - ATACTTTGTCGAGACCCGCTTCTTGCAGACTGGG A. Provide the mRNA sequence following transcription (include polarity) B. Provide the amino acid sequence using either the one letter or three letter abbreviations. Include polarity (N-or C-terminus) and be careful to start in the correct place: C. What if the "C" underlined above was changed to a T. What is the new codon? How does that affect the amino acid sequence? What...
please explain how to solve this problem, the answer is provided 9. Peptides: (20 pts.). A...
please explain how to solve this problem, the answer
is provided
9. Peptides: (20 pts.). A polypeptide (X) gives 7 fragments when treated with chymotrypsin (A-G). The same peptide also gives 9 fragments when treated with trypsin (I- IX). After Chymotrypsin A) Thr-Thr-Tyr-Ala-Gly-Phe-Phe-Ile-Asp- Lys B) Ala-Cys-Pro-Leu-Tyr-Gin-lle-Arg C) Met-Ser-Thr-Tyr-Pro-Gly-Arg D) Cys-Leu-Val-Phe-Ile-Lys E) Leu-Ala-Trp-Gly-Val F) Ser-Phe-Ala-Pro-Lys G) Met-Asp-Lys Afier Trypsin I) Ala-Pro-Lys-Met-Asp-Lys-Thr-Thr-Tyr II) Pro-Gly-Arg-Cys-Leu-Val-Phe III) Ile-Lys-Ala-Cys-Pro-Leu-Tyr IV) Ile-Asp-Lys-Met-Ser-Thr-Tyr V) Gin-Ile-Arg-Leu-Ala-Trp VIAla-Gly-Phe VII) Gly-Val VIII) Ser-Phe LX) Phe A) What is the primary...
Need help with #2 Clearly provide the 3-letter symbol for the correct sequence of cach amino...
Need help with #2
Clearly provide the 3-letter symbol for the correct sequence of cach amino acid in each of listings of the amino acids in the peptide or in any fragments are simply listed in alphabetical order. A subscriptive the number of that amino acid. Use parentheses to incorporate the unknown amino acids after each treatment 1. A five amino acid peptide contains: Arg. Glu, His, Phe, and Ser This peptide yields the following results when broken down into...
How many amino acids are there in the disease causing variant of the Amyloid-beta (Ab) peptide?...
How many amino acids are there in the disease causing variant of
the Amyloid-beta (Ab) peptide?
Determine which of these four peptides is most likely to become a beta sheet. Lys-Thr-Val-Ile-Trp-Pro-Phe-Tyr-Ile-Gln-Ile-Gly Arg-Ser-Tyr-Glu-Gly-Leu-Lys-Arg-Ile-Ala-Glu-Ser Ala-Glu-Met-Leu-Gln-Lys-Arg-Gly-Cys-Gly-Asp-Glu Met-Leu-Lys-Ala-Ser-Ala-Leu-Glu-Lys-Leu-Ser-Glu
15. Transcribe into mRNA and then translate into amino acids (protein) the following DNA sequence TAC...
15. Transcribe into mRNA and then translate into amino acids (protein) the following DNA sequence TAC ATG TCT AGG ATC. Write out the tRNA anticodons for each of the 5 codons as well. What is the complementary DNA sequence for the above DNA (the complementary sequence would be produced in DNA replication)? Suggested Format: DNA: TAC ATG TCT AGG ATC. Complementary: mRNA based on DNA: TRNAs that would pair with mRNA (the anticodon): Amino Acid Sequence: To transcribe the sequence...
Table 1: Partial RPE65 protein sequence (amino acids 41-60) for the 9-year-old LCA patient. Unmutated Protein Sequence Patient's Allele 1 Protein Sequence Patient's Allele 2 Protein Sequence START...Ser-Leu-Leu-Arg-Cyc-Gly-Pro-Gly-Leu-Phe-Glu-Val-Gly-Ser-Glu-Pro-Phe-Tyr- His-Gly...STOP START...Ser-Leu-Leu-Gin-Cyc-Gly-Pro-Gly-Leu-Phe-Glu-Val-Gly-Ser-Glu-Pro-Phe-Tyr- His-Gly...STOP START...Ser-Leu-Leu-Gin-Cyc-Gly-Pro-Gly-Leu-Phe-Glu-Val-Gly-Ser-Glu-Pro-Phe-Tyr- His-Gly...STOP Table 2. Partial RPE65 protein sequence (amino acids 61-70 and 291–300) for the 11-year-old LCA patient. Unmutated Protein Sequence Patient's Allele 1 Protein Sequence Patient's Allele 2 Protein Sequence START...Phe-Asp-Gly-Gln-Ala-Leu-Leu-His-Lys-Phe...lle-Ala-Asp-Lys-Lys-Arg-Lys-Lys- Tyr-Leu...STOP START...Phe-Asp-Gly-Gln-Ala-Leu-Leu-Tyr-Lys-Phe...lle-Ala-Asp-Lys-Lys-Arg-Lys-Lys- Tyr-Leu...STOP START...Phe-Asp-Gly-Gln-Ala-Leu-Leu-His-Lys-Phe...lle-Ala-Asp-Lys-STOP Source: Data from Russell et al. (2017). Use Tables 1 and 2 to...
Table 1: Partial RPE65 protein sequence (amino acids 41-60) for the 9-year-old LCA patient. Unmutated Protein Sequence Patient's Allele 1 Protein Sequence Patient's Allele 2 Protein Sequence START...Ser-Leu-Leu-Arg-Cyc-Gly-Pro-Gly-Leu-Phe-Glu-Val-Gly-Ser-Glu-Pro-Phe-Tyr- His-Gly...STOP START...Ser-Leu-Leu-Gin-Cyc-Gly-Pro-Gly-Leu-Phe-Glu-Val-Gly-Ser-Glu-Pro-Phe-Tyr- His-Gly...STOP START...Ser-Leu-Leu-Gin-Cyc-Gly-Pro-Gly-Leu-Phe-Glu-Val-Gly-Ser-Glu-Pro-Phe-Tyr- His-Gly...STOP Table 2. Partial RPE65 protein sequence (amino acids 61-70 and 291-300) for the 11-year-old LCA patient. Unmutated Protein Sequence Patient's Allele 1 Protein Sequence Patient's Allele 2 Protein Sequence START...Phe-Asp-Gly-Gln-Ala-Leu-Leu-His-Lys-Phe...lle-Ala-Asp-Lys-Lys-Arg-Lys-Lys- Tyr-Leu...STOP START...Phe-Asp-Gly-In-Ala-Leu-Leu-Tyr-Lys-Phe...Ile-Ala-Asp-Lys-Lys-Arg-Lys-Lys- Tyr-Leu...STOP START...Phe-Asp-Gly-Gln-Ala-Leu-Leu-His-Lys-Phe...lle-Ala-Asp-Lys-STOP Source: Data from Russell et al. (2017). Use Tables 1 and 2 to...
What amino acid would the Manticodon code for RNA codon table 2nd position Tot position СТА Tyr Phe Phe > eu eu Oulaa Jooo 9999 stop stop eu eu eu Let 0 - puchbucobucusura BER < Val Val Asp Ala Asp Ala Glu Ala Glu Amino Acids Keu Pro Pro His Weu Leu Gin lle Pro Thr Thr Thr Thr Asn Asn lle Ser Ser Arg lle Met Lys Lys bucoucouco Arg > Asp Asp Val Val Val Val Ala...
Question 10 (15 points) Given the following sequence for a template strand of DNA 3 - ATACTTTGTCGAGACCCGCTTCTTGCAGACTGGG A. Provide the mRNA sequence following transcription (include polarity) B. Provide the amino acid sequence using either the one letter or three letter abbreviations. Include polarity (N-or C-terminus) and be careful to start in the correct place: C. What if the "C" underlined above was changed to a T. What is the new codon? How does that affect the amino acid sequence? What...
please explain how to solve this problem, the answer
is provided
9. Peptides: (20 pts.). A polypeptide (X) gives 7 fragments when treated with chymotrypsin (A-G). The same peptide also gives 9 fragments when treated with trypsin (I- IX). After Chymotrypsin A) Thr-Thr-Tyr-Ala-Gly-Phe-Phe-Ile-Asp- Lys B) Ala-Cys-Pro-Leu-Tyr-Gin-lle-Arg C) Met-Ser-Thr-Tyr-Pro-Gly-Arg D) Cys-Leu-Val-Phe-Ile-Lys E) Leu-Ala-Trp-Gly-Val F) Ser-Phe-Ala-Pro-Lys G) Met-Asp-Lys Afier Trypsin I) Ala-Pro-Lys-Met-Asp-Lys-Thr-Thr-Tyr II) Pro-Gly-Arg-Cys-Leu-Val-Phe III) Ile-Lys-Ala-Cys-Pro-Leu-Tyr IV) Ile-Asp-Lys-Met-Ser-Thr-Tyr V) Gin-Ile-Arg-Leu-Ala-Trp VIAla-Gly-Phe VII) Gly-Val VIII) Ser-Phe LX) Phe A) What is the primary...
Need help with #2
Clearly provide the 3-letter symbol for the correct sequence of cach amino acid in each of listings of the amino acids in the peptide or in any fragments are simply listed in alphabetical order. A subscriptive the number of that amino acid. Use parentheses to incorporate the unknown amino acids after each treatment 1. A five amino acid peptide contains: Arg. Glu, His, Phe, and Ser This peptide yields the following results when broken down into...
How many amino acids are there in the disease causing variant of
the Amyloid-beta (Ab) peptide?
Determine which of these four peptides is most likely to become a beta sheet. Lys-Thr-Val-Ile-Trp-Pro-Phe-Tyr-Ile-Gln-Ile-Gly Arg-Ser-Tyr-Glu-Gly-Leu-Lys-Arg-Ile-Ala-Glu-Ser Ala-Glu-Met-Leu-Gln-Lys-Arg-Gly-Cys-Gly-Asp-Glu Met-Leu-Lys-Ala-Ser-Ala-Leu-Glu-Lys-Leu-Ser-Glu
15. Transcribe into mRNA and then translate into amino acids (protein) the following DNA sequence TAC ATG TCT AGG ATC. Write out the tRNA anticodons for each of the 5 codons as well. What is the complementary DNA sequence for the above DNA (the complementary sequence would be produced in DNA replication)? Suggested Format: DNA: TAC ATG TCT AGG ATC. Complementary: mRNA based on DNA: TRNAs that would pair with mRNA (the anticodon): Amino Acid Sequence: To transcribe the sequence...
Most questions answered within 3 hours.
-
The x component of the velocity of an object vibrating
along the x-axis obeys the equation...
asked 45 minutes ago -
A junction box contains two trade size 2 raceways on the left
side, and two trade...
asked 1 hour ago -
Atmospheric Mass
Venus and Earth have about the same mass and radius, but the
atmospheric pressure...
asked 1 hour ago -
5. Discuss the use of fault tree analysis (FTA) for risk
assessment (maximum one paragraph).
asked 3 hours ago -
Given that a sample of aluminium oxide has a Young's modulus of
393 GPa and a...
asked 4 hours ago -
At a certain temperature, the equilibrium constant, Kc, for this
reaction is 53.3.
H2(g)+I2(g)−⇀↽−2HI(g)Kc=53.3
At this...
asked 5 hours ago -
Question1 ) The STL provides similiar classes called stack and
queue, both of which gave functions...
asked 6 hours ago -
For Questions 1-4, assume you have 5 bits available:
1. For (positive) integers: What is the...
asked 6 hours ago -
convert grams into vloume with the density of water being at
.997514 g/cm^3 at 23.1 Celsuis...
asked 8 hours ago -
Foreman company obtained a $20,000, 6% loan on May 1, 2018.
Principal and interest will be...
asked 9 hours ago -
5. Problem 11.05 (Discounted Payback)
eBook
Project L costs $60,000, its expected cash inflows are $14,000
per...
asked 9 hours ago -
1. Which of the following is true about politics and health
organizations?
A. Health organizations are...
asked 9 hours ago