Homework Answers
Add Answer to:
Practice Problems 1. For the peptide on the right, give the formal name, the primary sequence...
HO Practice Problems 1. For the peptide on the right, give the formal name, the primary sequence ...
HO Practice Problems 1. For the peptide on the right, give the formal name, the primary sequence using the 3-letter abbreviations of the amino acids, and the classification of each amino acid. 0-1 0 H O но он
HO Practice Problems 1. For the peptide on the right, give the formal name, the primary sequence using the 3-letter abbreviations of the amino acids, and the classification of each amino acid. 0-1 0 H O но он
Explain this question please! Name (4 ofer to the Table of Amino Acids at the beginning of the exam to help solve this problem. Polypeptide I is a 12-mer and has the following amino acid compositi...
Explain this question please!
Name (4 ofer to the Table of Amino Acids at the beginning of the exam to help solve this problem. Polypeptide I is a 12-mer and has the following amino acid composition: Ala, Arg, 2 His, Leu, 2 Lys, 2 Phe, Ser, Thr, Trp Edman degradation of I shows that its N-terminal amino acid is His. Chymotrypsin cleavage of I yields peptide fragments A-D.Trypsin cleavage of I gives peptide fragments E-G. Shown below is the amino...
What amino acid sequence does the following mRNA nucleotide sequence specify? 5′−AUGAACCUAUGC−3′ Express the sequence of...
What amino acid sequence does the following mRNA nucleotide sequence specify? 5′−AUGAACCUAUGC−3′ Express the sequence of amino acids using the three-letter abbreviations, separated by hyphens (e.g., Met-Ser-Thr-Lys-Gly).
please explain how to solve this problem, the answer is provided 9. Peptides: (20 pts.). A...
please explain how to solve this problem, the answer
is provided
9. Peptides: (20 pts.). A polypeptide (X) gives 7 fragments when treated with chymotrypsin (A-G). The same peptide also gives 9 fragments when treated with trypsin (I- IX). After Chymotrypsin A) Thr-Thr-Tyr-Ala-Gly-Phe-Phe-Ile-Asp- Lys B) Ala-Cys-Pro-Leu-Tyr-Gin-lle-Arg C) Met-Ser-Thr-Tyr-Pro-Gly-Arg D) Cys-Leu-Val-Phe-Ile-Lys E) Leu-Ala-Trp-Gly-Val F) Ser-Phe-Ala-Pro-Lys G) Met-Asp-Lys Afier Trypsin I) Ala-Pro-Lys-Met-Asp-Lys-Thr-Thr-Tyr II) Pro-Gly-Arg-Cys-Leu-Val-Phe III) Ile-Lys-Ala-Cys-Pro-Leu-Tyr IV) Ile-Asp-Lys-Met-Ser-Thr-Tyr V) Gin-Ile-Arg-Leu-Ala-Trp VIAla-Gly-Phe VII) Gly-Val VIII) Ser-Phe LX) Phe A) What is the primary...
7. A peptide was isolated from sheep hypothalamus and subjected to sequence analysis. The experimental data...
7. A peptide was isolated from sheep hypothalamus and subjected to sequence analysis. The experimental data are as follows. Deduce the amino acid sequence from this data. a. Composition (2Ala, 2Gly, Thr, Phe, Lys, His, Ser, Trp, Arg, Val) b. Reaction of dinitrofluorobenzene with the intact peptide yielded DNP-Thr. A brief treatment with carboxypeptidase a yielded glycine. c. Trypsin digestion yielded three fragments: i. Phe, Thr, Ala, Lys ii. Gly, Val iii. Trp, His, Ser, Gly, Arg, Ala Treatment of...
Question 10 (15 points) Given the following sequence for a template strand of DNA 3 -...
Question 10 (15 points) Given the following sequence for a template strand of DNA 3 - ATACTTTGTCGAGACCCGCTTCTTGCAGACTGGG A. Provide the mRNA sequence following transcription (include polarity) B. Provide the amino acid sequence using either the one letter or three letter abbreviations. Include polarity (N-or C-terminus) and be careful to start in the correct place: C. What if the "C" underlined above was changed to a T. What is the new codon? How does that affect the amino acid sequence? What...
Need help with #2 Clearly provide the 3-letter symbol for the correct sequence of cach amino...
Need help with #2
Clearly provide the 3-letter symbol for the correct sequence of cach amino acid in each of listings of the amino acids in the peptide or in any fragments are simply listed in alphabetical order. A subscriptive the number of that amino acid. Use parentheses to incorporate the unknown amino acids after each treatment 1. A five amino acid peptide contains: Arg. Glu, His, Phe, and Ser This peptide yields the following results when broken down into...
10. The peptide shown has the amino acid sequence: A. Val-Ser-Ile-Glu-Lys B. Lys-Glu-Ile-Ser-Val C. Thr-Asp-Leu-Gln-Arg D....
10. The peptide shown has the amino acid sequence: A. Val-Ser-Ile-Glu-Lys B. Lys-Glu-Ile-Ser-Val C. Thr-Asp-Leu-Gln-Arg D. Val-Asp-Ile-Glu-Arg 11. Which of the following describes the entire three- dimensional structure of a single polypeptide? A. Secondary structure B. Quaternary structure C. Tertiary structure D. Primary structure 12. What is the primary driving force in the formation of protein tertiary structure? A. Energy released when additional ion pairs are formed. B. The exclusion of non-polar substances from aqueous solution. C. The formation of...
Give the amino acid sequence in the following tetrapeptide using both 3-letter and 1-letter abbreviations for the amino acids. (Capitalize amino acid abbreviations appropriately.) ball & stick la...
Give the amino acid sequence in the following tetrapeptide using both 3-letter and 1-letter abbreviations for the amino acids. (Capitalize amino acid abbreviations appropriately.) ball & stick labels Sequence 3-letter abbreviations) (Separate abbreviations with hyphens.) Sequence (1-letter abbreviations) Do not separate abreviations with hyphens.)
Give the amino acid sequence in the following tetrapeptide using both 3-letter and 1-letter abbreviations for the amino acids. (Capitalize amino acid abbreviations appropriately.) ball & stick labels Sequence 3-letter abbreviations) (Separate abbreviations with hyphens.) Sequence...
anyone can help me with it? A protein biochemist attempted to determine the amino acid sequence...
anyone can help me with it?
A protein biochemist attempted to determine the amino acid sequence of a decapeptide. Use the results from the trypsin, chymotrypsin, and cyanogen bromide treatments to suggest the amino acid sequence of this decapeptide. Trypsin digestion gave two fragments with multiple residues (not in order): • T1: Ala, Arg, Phe, Gly, Thr, Trp, Tyr • T2: Lys, Met, Val Chymotrypsin digestion gave four fragments with multiple residues (not in order): • CT1: Ala, Phe •...
HO Practice Problems 1. For the peptide on the right, give the formal name, the primary sequence using the 3-letter abbreviations of the amino acids, and the classification of each amino acid. 0-1 0 H O но он
HO Practice Problems 1. For the peptide on the right, give the formal name, the primary sequence using the 3-letter abbreviations of the amino acids, and the classification of each amino acid. 0-1 0 H O но он
Explain this question please!
Name (4 ofer to the Table of Amino Acids at the beginning of the exam to help solve this problem. Polypeptide I is a 12-mer and has the following amino acid composition: Ala, Arg, 2 His, Leu, 2 Lys, 2 Phe, Ser, Thr, Trp Edman degradation of I shows that its N-terminal amino acid is His. Chymotrypsin cleavage of I yields peptide fragments A-D.Trypsin cleavage of I gives peptide fragments E-G. Shown below is the amino...
please explain how to solve this problem, the answer
is provided
9. Peptides: (20 pts.). A polypeptide (X) gives 7 fragments when treated with chymotrypsin (A-G). The same peptide also gives 9 fragments when treated with trypsin (I- IX). After Chymotrypsin A) Thr-Thr-Tyr-Ala-Gly-Phe-Phe-Ile-Asp- Lys B) Ala-Cys-Pro-Leu-Tyr-Gin-lle-Arg C) Met-Ser-Thr-Tyr-Pro-Gly-Arg D) Cys-Leu-Val-Phe-Ile-Lys E) Leu-Ala-Trp-Gly-Val F) Ser-Phe-Ala-Pro-Lys G) Met-Asp-Lys Afier Trypsin I) Ala-Pro-Lys-Met-Asp-Lys-Thr-Thr-Tyr II) Pro-Gly-Arg-Cys-Leu-Val-Phe III) Ile-Lys-Ala-Cys-Pro-Leu-Tyr IV) Ile-Asp-Lys-Met-Ser-Thr-Tyr V) Gin-Ile-Arg-Leu-Ala-Trp VIAla-Gly-Phe VII) Gly-Val VIII) Ser-Phe LX) Phe A) What is the primary...
7. A peptide was isolated from sheep hypothalamus and subjected to sequence analysis. The experimental data are as follows. Deduce the amino acid sequence from this data. a. Composition (2Ala, 2Gly, Thr, Phe, Lys, His, Ser, Trp, Arg, Val) b. Reaction of dinitrofluorobenzene with the intact peptide yielded DNP-Thr. A brief treatment with carboxypeptidase a yielded glycine. c. Trypsin digestion yielded three fragments: i. Phe, Thr, Ala, Lys ii. Gly, Val iii. Trp, His, Ser, Gly, Arg, Ala Treatment of...
Question 10 (15 points) Given the following sequence for a template strand of DNA 3 - ATACTTTGTCGAGACCCGCTTCTTGCAGACTGGG A. Provide the mRNA sequence following transcription (include polarity) B. Provide the amino acid sequence using either the one letter or three letter abbreviations. Include polarity (N-or C-terminus) and be careful to start in the correct place: C. What if the "C" underlined above was changed to a T. What is the new codon? How does that affect the amino acid sequence? What...
Need help with #2
Clearly provide the 3-letter symbol for the correct sequence of cach amino acid in each of listings of the amino acids in the peptide or in any fragments are simply listed in alphabetical order. A subscriptive the number of that amino acid. Use parentheses to incorporate the unknown amino acids after each treatment 1. A five amino acid peptide contains: Arg. Glu, His, Phe, and Ser This peptide yields the following results when broken down into...
10. The peptide shown has the amino acid sequence: A. Val-Ser-Ile-Glu-Lys B. Lys-Glu-Ile-Ser-Val C. Thr-Asp-Leu-Gln-Arg D. Val-Asp-Ile-Glu-Arg 11. Which of the following describes the entire three- dimensional structure of a single polypeptide? A. Secondary structure B. Quaternary structure C. Tertiary structure D. Primary structure 12. What is the primary driving force in the formation of protein tertiary structure? A. Energy released when additional ion pairs are formed. B. The exclusion of non-polar substances from aqueous solution. C. The formation of...
Give the amino acid sequence in the following tetrapeptide using both 3-letter and 1-letter abbreviations for the amino acids. (Capitalize amino acid abbreviations appropriately.) ball & stick labels Sequence 3-letter abbreviations) (Separate abbreviations with hyphens.) Sequence (1-letter abbreviations) Do not separate abreviations with hyphens.)
Give the amino acid sequence in the following tetrapeptide using both 3-letter and 1-letter abbreviations for the amino acids. (Capitalize amino acid abbreviations appropriately.) ball & stick labels Sequence 3-letter abbreviations) (Separate abbreviations with hyphens.) Sequence...
anyone can help me with it?
A protein biochemist attempted to determine the amino acid sequence of a decapeptide. Use the results from the trypsin, chymotrypsin, and cyanogen bromide treatments to suggest the amino acid sequence of this decapeptide. Trypsin digestion gave two fragments with multiple residues (not in order): • T1: Ala, Arg, Phe, Gly, Thr, Trp, Tyr • T2: Lys, Met, Val Chymotrypsin digestion gave four fragments with multiple residues (not in order): • CT1: Ala, Phe •...
Most questions answered within 3 hours.
-
The denaturation of proteins can be described by the
equilibrium
F⇌U
where F and U represent...
asked 59 minutes ago -
Please answer what the maximum and minimum force is, and the
angle on the ion is...
asked 1 hour ago -
implement a program that reads a number of rows and a symbol.
The program will draw...
asked 1 hour ago -
Assume that when adults with smartphones are randomly selected,
45% use them in meetings or classes....
asked 1 hour ago -
Determine the number of formula units of
Na2SO4 and moles of oxygen contained in 8.11
moles...
asked 1 hour ago -
Explain in steps on the following code
What would be the output when executed
using System;...
asked 1 hour ago -
Given the information in the table, which of the following
statements is CORRECT?
Stock A
Stock...
asked 1 hour ago -
Write MARIE assembly language programs that do the following:
Write a program that inputs an integer...
asked 1 hour ago -
Explain an understanding of services and protocols.
Explain the job of DNS.
Explain the three email...
asked 1 hour ago -
(As soon as possible) Balance each of the following equations
according to the half-reaction method:
H2O2(aq)...
asked 2 hours ago -
A thin rod with a mass of 3.5kg and a length L=1.5 m is oriented
horizontally....
asked 2 hours ago -
Inheritance pattern in BRCA 1
Describe the inheritance pattern of BRCA 1 Is it recessive or...
asked 2 hours ago