Homework Answers
Add Answer to:
If the size of your gene (DNA fragment) was 1815 bp, what would be the likely...
(3) Polymorphism analysis of the sickle cell gene fragment (317 bp) that helps to make hemoglobin....
(3) Polymorphism analysis of the sickle cell gene fragment (317 bp) that helps to make hemoglobin. A lab technician is conducting the polymorphism analysis of the sickle cell gene fragment (317 bp) using PCR and restriction digestion by Taq 1 on six individuals. A) Schematic representation of restriction sites of Taq l in the normal gene fragment. Two normal S1 and S2 restriction sites produce DNA fragments of 174, 78, and 65 bp. The sickle cell mutation removes the S2...
amplify a 161 bp fragment of the vaca gene which is only found in H. pylori....
amplify a 161 bp fragment of the vaca gene which is only found in H. pylori. You culture bacteria from gastric biopsies, extract the DNA, run the PCR, and run the gel elctrophoresis according to standard techniques. An image of the gel electrophoresis is below. 161 bp 500 bp 400 bp 300 bp 200 bp 100 bp The lanes on your gel contain the following: . M) Mass Ladder to estimate size 1) Positive Control using DNA from a lab...
1. Molecular cloning has made it possible to take a DNA fragment from nuclear DNA, containing...
1. Molecular cloning has made it possible to take a DNA fragment from nuclear DNA, containing an entire gene, and insert it into a cloning plasmid just behind a phage promoter. This means that the cloned gene can be transcribed in a test tube using a commercially available phage RNA polymerase protein. If you were to use agarose gel electrophoresis to separate RNA according to size, would the RNA produced in the test tube show any differences with RNA from...
7. Explain the procedure for cloning DNA fragment into the plasmid PBR322 (shown on the right) (S...
7. Explain the procedure for cloning DNA fragment into the plasmid PBR322 (shown on the right) (S pts.). The gene fragment of interest was obtained by digestion of chromosomal DNA with the restriction enzyme Sall and subsequent purification using agarose gel electrophoresis. Which antiblotic would you use in the final step of the cloning procedure, and Pst why? EcoR Sal Ampicillin Tetracycline resistanica(Ter Amp) PBR322 4,361 bp) Origin of replicatiorn (ori Pvull 8. Assume that your gene fragment from question...
Assume a size of 2700 bp for the pUC19 vector and a size of 730 bp...
Assume a size of 2700 bp for the pUC19 vector and a size of 730 bp for the GFP DNA insert. What mass ratio (vector:insert) will give you a molar ratio of 1:1? Of 1:3? thats a molecular GFP PCR lab
You need to prepare sequencing libraries of two different DNA fragment sizes. One library should contain...
You need to prepare sequencing libraries of two different DNA fragment sizes. One library should contain DNA fragments of approximately 800 bp and the other 5000 bp. You are going to fragment your DNA using a nebulizer. Indicate the correct statement(s) below: a. To obtain a library of 800 bp fragments, you need to apply lower gas pressure during the nebulization process than for the preparation of the 5000 bp fragment library. b. To obtain a library of 5000 bp...
After separating DNA fragments according to size, identifying a fragment of interest a. can be done...
After separating DNA fragments according to size, identifying a fragment of interest a. can be done by Northern blotting b. requires the use of a probe that is complementary to the gene of interest c. requires transferring the DNA to a solid support, such as a saran membrane d. a and b e. all of the above
Here is a DNA sequence obtained from sequencing. Does this sequence code for a gene? How can...
Here is a DNA sequence obtained from sequencing. Does this sequence code for a gene? How can you tell? Is this a eukaryotic or prokaryotic gene? How can you tell? If it does code for a gene, what is the protein sequence encoded by this DNA sequence? Explain how you can tell. Are there any regulatory regions encoded by this DNA sequence? How can you tell?TTATGTATGTAGATGGGGCAGCTAACAGGGAGACTAAATTAGGAAAAGCAGGTTATGTTACTGACAGAGGAAGACAAAAGGTTGTTTCCATAACTGACACAACAAATCAGAAGACAGAGTTACAAGCAATTCATCTAGCTTTGCAGGATTCGGGATCAGAAGTAAACATAGTAACAGACTCACAATATGCATTAGGGATCATTCAAGCACAACCAGATAAAAGTGAATCAGAGTTAGTTAGCCAAATAATAGAGCAGTTAATAAATAAGGAAAAGATCTACCTGGCATGGGTACCAGCACATAAAGGAATTGGAGGAAATGAACAAGTAGATAAATTAGTTAGTGCTGGAGTCAGGAAAGTATAGTTT
You have isolated a DNA fragment containing a human gene involved in lung cancer and are...
You have isolated a DNA fragment containing a human gene involved in lung cancer and are working inserting it into a standard plasmid vector used in molecular cloning which has a multiple cloning site in the lacZ gene. After cutting the DNA fragment and the vector with the same restriction enzyme and ligating the cut DNA, you transform bacteria with hopefully the recombinant vector. How do you expect to identify bacteria with the recombinant vector? A. Bacteria with the recombinant...
You've identified a gene likely involved in a human disease.
Question 3You've identified a gene likely involved in a human disease. You BLAST the predicted protein sequence for the gene against the database of known protein sequences and see that a domain of your unknown protein is similar to the nuclease domain of a RISC complex protein. Therefore... Select one: a. The unknown gene is likely to be a microRNA gene b. The unknown protein is likely to be a nuclease that cuts RNA c. The unknown protein is likely to be a nuclease...
(3) Polymorphism analysis of the sickle cell gene fragment (317 bp) that helps to make hemoglobin. A lab technician is conducting the polymorphism analysis of the sickle cell gene fragment (317 bp) using PCR and restriction digestion by Taq 1 on six individuals. A) Schematic representation of restriction sites of Taq l in the normal gene fragment. Two normal S1 and S2 restriction sites produce DNA fragments of 174, 78, and 65 bp. The sickle cell mutation removes the S2...
amplify a 161 bp fragment of the vaca gene which is only found in H. pylori. You culture bacteria from gastric biopsies, extract the DNA, run the PCR, and run the gel elctrophoresis according to standard techniques. An image of the gel electrophoresis is below. 161 bp 500 bp 400 bp 300 bp 200 bp 100 bp The lanes on your gel contain the following: . M) Mass Ladder to estimate size 1) Positive Control using DNA from a lab...
7. Explain the procedure for cloning DNA fragment into the plasmid PBR322 (shown on the right) (S pts.). The gene fragment of interest was obtained by digestion of chromosomal DNA with the restriction enzyme Sall and subsequent purification using agarose gel electrophoresis. Which antiblotic would you use in the final step of the cloning procedure, and Pst why? EcoR Sal Ampicillin Tetracycline resistanica(Ter Amp) PBR322 4,361 bp) Origin of replicatiorn (ori Pvull 8. Assume that your gene fragment from question...
Most questions answered within 3 hours.
-
Please answer true or false. Words
cannot be changed or added in to make it true...
asked 53 minutes ago -
An empty test tube weighs 15.923 grams. Then,
MgCl2•6H2O is added into the test tube. After...
asked 54 minutes ago -
(a) A piston at 6.1 atm contains a gas that occupies a volume of
3.5 L....
asked 54 minutes ago -
Assume memory access is 10 units of time and disk access is
10000 units of time....
asked 1 hour ago -
1. Are all good samples random?
2. Magazines often report surveys giving statistics such as “63%...
asked 1 hour ago -
Under all the various types of market structures, firms
must eventually earn some economic profits for...
asked 1 hour ago -
Consider the following fitness regime for a single locus trait
with two co-dominant alleles: w11 =...
asked 1 hour ago -
A large cable company reports the following.
80% of its customers subscribe to its cable TV...
asked 1 hour ago -
Please answer the question in brief.
Discuss the role of ERP in organizations. Are ERP tools...
asked 1 hour ago -
Discuss the pros and cons of collaborative software such
as SameTime. Does it increase productivity? What...
asked 1 hour ago -
Buying your in-laws a gift because it’s expected is
due to the ____________ motive of gift-giving....
asked 1 hour ago -
Calculate the expected value, the variance, and the standard
deviation of the given random variable X....
asked 2 hours ago