This question is based upon a very straight forward formula that is used in ligation of insert and vector in genetics.
please see the solution in the image.
Assume a size of 2700 bp for the pUC19 vector and a size of 730 bp...
4. The vector below is called PUC19. It has a Polylinker site, also called a multiple cloning site ( MCS) where a gene of interest can be added so bacteria can express it as protein. The sequence of the MCS is show with the location of the restriction sites. E Xbal Sail Se Sphi Hindill GAATTCGAGCTCGGTACCOGGGGATCCTCTAGAGTCGACCTGCAGGCATGCAAGCTTGG SACK Smal 0 2500 lacza Polylinker 396-454 500 amp 2000 PUC19 2686 bp ori 1000 If you wanted to insert a gene into this...
In order to follow the 3:1 insert to vector molar ratio for ligation, 0.06 pmol of the insert and 0.02 pmol of the vector is added to a microcentrifuge tube, along with T4 DNA ligase, appropriate buffer, and diH2O.a. Calculate the volume of digested and BamHI-free pUC19 to add to the ligation reaction. Round to the nearest one-tenth in microliter. Include units.b. The insert DNA, which contains the inlA gene, is 2410 bp. After digesting with BamHI and cleaned using the in silica...
amplify a 161 bp fragment of the vaca gene which is only found in H. pylori. You culture bacteria from gastric biopsies, extract the DNA, run the PCR, and run the gel elctrophoresis according to standard techniques. An image of the gel electrophoresis is below. 161 bp 500 bp 400 bp 300 bp 200 bp 100 bp The lanes on your gel contain the following: . M) Mass Ladder to estimate size 1) Positive Control using DNA from a lab...
The molar ratio of insert DNA to vector DNA used in a ligation is generally about 3:1. Using a vector that is 12 kb and an insert that is 4 kb, how much insert would you use if you used 30 ng of vector? Give your answer in ng and only write the number, do not include the units.
The molar ratio of insert DNA to vector DNA used in a ligation is generally about 2:1. Using a vector that is 8 kb and an insert that is 4 kb, how much insert would you use if you used 20 ng of vector?
3. The insertion of a 4,700-bp Doc retroposon is in the MIDDLE of the promoter region of the white gene as indicated between P1 and P3 (467bp) in Figure below. It is the same distance between P1 and point A (the beginning of retroposon) and between point C (the end of retroposon) as and P3. The retroposon specific primer P2 is 100 bp downstream of A. Use Primer sets P1, P2, P3 to amplify the white one gene promoter and...
Purification & Size Determination of GFP & BFP ment estions 1. What is the anticipated difference in apparent molecular weight between pFluoro- Green" (gfp) and pFluoroBlue™ (bfp) as detected by denatured SDS- polyacrylamide gel analysis? 2. Why is the molecular sieving matrix swelled prior to packing the column? 3. What is the basis of molecular sieve chromatography? 4. Can molecular sieve chromatography columns be used to separate DNA fragments?
Cloning / Subcloning When subcloning engineering new plasmids, by inserting new DNA fragments (inserts) me plasmids (now called a vector because it will carry your gene of interest) it is important to considering existing genes / DNA elements. If a site is in the middle of a gene, you could lose or destroy that gene. If there are multiple sites for an enzyme, when you paste them together, multiple possible outcomes can arise. This is undesirable, because it confounds verification...
Molecular Bio lab. HELP!! Here is the first part: the sequence traces and the entire sequence. i just need the last 3 tasks. i color coded the ends so you can see where it overlaps and connects In the files section for your group there is a simulated output from an automated DNA sequencer using a variation of the classic Sanger method. (If you want to print it, it is formatted for legal sized paper.) This sequence encodes a protein...
After PCR is performed the products are run out on an agarose gel. In the figure below, grey bands represent the wells the PCR product was loaded into. The white bands represent DNA fragments produced by PCR. The target fragment amplified by the primers was 1,500 bp in size. The ladder is a standard DNA ladder containing bands of various sizes between 5,000 and 1,000 bp. The negative control contained only molecular grade water*. The positive control contained DNA known...