ZuoTi.Pro
Question

If the template strand of the DNA at a gene locus has 3' ... CAA TAA..5'...

If the template strand of the DNA at a gene locus has 3' ... CAA TAA..5' and a mutation at that locus has 3' ... CAA AAA ...5', what would be the SNP genotype of an individual heterozygous for the mutation at this gene locus?

science   biology   
0 0
Add a comment Improve this question Transcribed image text
Next > < Previous
Sort answers by oldest

Homework Answers

Answer #1

In this case there is change in the 4th nucleotide T to A which will be can not be cut by specific restriction enzyme, so such will be a heterozygous

0 0
Add a comment
Know the answer?
Add Answer to:
If the template strand of the DNA at a gene locus has 3' ... CAA TAA..5'...
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Log In

Sign Up

Not the answer you're looking for? Ask your own homework help question. Our experts will answer your question WITHIN MINUTES for Free.
Similar Homework Help Questions

  • A template strand of DNA in a gene reads 3’ CCA AGC TCT 5’. Using the...

    A template strand of DNA in a gene reads 3’ CCA AGC TCT 5’. Using the codon chart provided, answer the following questions: -What is the sequence of amino acids that is produced when this gene is translated? -If a mutation causes a substitution (an A instead of a T) 3’ CCA AGC ACT 5’, what effect will it have on the mRNA transcript AND on the protein? -What do we call this type of mutation? Second letter U С...

  • *Template Strand of DNA 3. The following shows the first portion of a DNA strand of...

    *Template Strand of DNA 3. The following shows the first portion of a DNA strand of a gene that is 2,500 base pairs long. AUG TACȚTCCCGGAGCCC--- TAAG LLL ODRAL a. What is the amino acid sequence encoded for by this strand starting with the T nucleotide on the left? Met b. Give an example of a synonymous substitution (a silent mutation) that could occur in the second codon of the DNA strand. c. Give an example of a nonsense mutation...

  • 1. The template DNA strand of the MCB gene is shown below: 5’ ACAGGAGAGTGGAAACATG 3’ What...

    1. The template DNA strand of the MCB gene is shown below: 5’ ACAGGAGAGTGGAAACATG 3’ What is the sequence of the mRNA produced from this?                                            A) 3’ TGTCCTCTCACCTTTGUAC 5’ B) 3’ UGUCCUCUCACCUUUGUAC 5’ C) 5’ ACAGGAGAGUGGAAACAUG 3’ D) 5’ UGUCCUCUCACCUUUGUAC 3’ E) 3’ ACAGGAGAGUGGAAACAUG 5’ 2. The template DNA strand of the MCB gene is shown below: 5’ ACAGGAGAGTGGAAACATG 3’ What is the amino acid sequence that the MCB gene codes for? A) MET – PHE – THR –...

  • 1. If a template strand reads: 3’-TTG CAA TGC AAC-5’ what will the new strand read?...

    1. If a template strand reads: 3’-TTG CAA TGC AAC-5’ what will the new strand read? 2. How are new nucleotide monomers attached to the growing strand? What is the reaction that takes place? How is dATP different from ATP? 3. Why does the lagging strand exist? 4. In the lagging strand, what is the enzyme that replaces the RNA primer with DNA? What enzyme then connects the two fragments together? 5. The replication machinery is very accurate but every...

  • If the DNA template strand sequence at a particular region of a gene is 3-GGA-5. What...

    If the DNA template strand sequence at a particular region of a gene is 3-GGA-5. What amino acid would this result in after transcription and translation? Pro (Proline) Ser (Serine) Val (Valine) Arg (Arginine) Question 20 1 pts What is created during transcription? a strand of codons O a strand of tRNA a strand of anticodons a polypeptide • a strand of DNA IPS Which letter (representing a phase of the cell cycle) would you observe (S phase) synthesis and...

  • Use the following DNA sequence as the template strand to answer these questions. (8 points) 5’-...

    Use the following DNA sequence as the template strand to answer these questions. (8 points) 5’- GAT CCT GCC TAA -3’ Draw the non-template DNA sequence, the mRNA sequence and the resulting peptide. Label the terminus of the DNA and peptide!! Draw a point mutation. Is this a transition mutation or transverse mutation? Did it change the amino acid sequence(draw out the peptide)? 4 bp insertion, and the resulting peptide. 2 bp deletion, and the resulting peptide. A copy number...

  • Gene Expression Exercise Located below is a gene sequence from the coding strand of DNA 5’ATGCCCGGGTGTCGTAGTTGA3’...

    Gene Expression Exercise Located below is a gene sequence from the coding strand of DNA 5’ATGCCCGGGTGTCGTAGTTGA3’ Complete the complementary sequence for the template strand. _________________________________________________ What would the mRNA be based upon the template strand above? mRNA___________________________________________ What would the primary linear structure of the protein be based upon the mRNA strand above? Intro to Biology 1005

  • DNA sequence of a one strand of a gene to be transcribed is: 3’ — AGTCCGATGGGCT...

    DNA sequence of a one strand of a gene to be transcribed is: 3’ — AGTCCGATGGGCT GA — 5’ the sequence of the MRNA is: 3’ — AGUCCGAUGGGCTGA — 5’ the sequence of the DNA strand shown above is that of the: a. template strand b. coding strand

  • The following sequence of nucleotides is found in the DNA Template strand of a gene: ATTCCCAATAGAT...

    The following sequence of nucleotides is found in the DNA Template strand of a gene: ATTCCCAATAGAT LEFT RIGHT Direction of RNA pol Il movement Which of the following is correct? The mRNA sequence and polarity is: OA. 5' AUCUAUUGGGAAU 3' OB. The 5' end of the DNA template is on the LEFT OC. The 5' end of the DNA is on the RIGHT OD. A and B O E. A and C

  • 11.36 The following portion of DNA is in the template DNA strand: 3' GCT] TIT |...

    11.36 The following portion of DNA is in the template DNA strand: 3' GCT] TIT | CAA | AAAS , a. Write the corresponding mRNA section. Show the nucleic acid sequence as triplets and label the 5' and the 3' ends. b. Write the anticodons corresponding to the codons on the mRNA c. Write the three-letter and one-letter amino-acid sequence that will be placed in a peptide chain.

ADVERTISEMENT
Free Homework Help App
Download From Google Play
Scan Your Homework
to Get Instant Free Answers
Need Online Homework Help?
Ask a Question
Get Answers For Free
Most questions answered within 3 hours.
ADVERTISEMENT
ADVERTISEMENT
ADVERTISEMENT