22. The following is a promoter that is recognized by the sigma (?) factor of the...
22. The following is a promoter that is recognized by the sigma (?) factor of the E. coliRNA polymerase: 5’-ACGAAAAACAGGTATTGACATCATGAAGTAACATGCAGTATAATACAAATCG
The bold Gdenotes the transcription start site (+1). Underline, highlight or type the cis-acting elements that will be recognized by the sigma factor.
23. The following sequence is a portion of a eukaryotic promoter. The transcription start site is indicated as the red/bold “g”.
5’-CGGCTCAATAAAATAACAGGAGTCTATAAAAGCGTGGGGACAGTTCAGGAGGGG
TBP binds a cis-acting element within this sequence. What is the coordinate (e.g. +5, -5 etc…) of the 3’ deoxynucleotide of this cis-acting element?
Homework Answers
Add Answer to:
22. The following is a promoter that is recognized by the sigma
(?) factor of the...
please explain a and b shkaryote 4. Transcription. The DNA below contains a promoter sequence recognized...
please explain a and b
shkaryote 4. Transcription. The DNA below contains a promoter sequence recognized by E. coli RNA polymerase (NAF) TOUCA s. 5'-AACGTAACTGAATTCCGCAATGGCATGGCATTGCTCATTATACTTAGTCTAATATGTCAA-3' 3'-TTGCATTGACTTAAGGCGTTACCGTACCGTAACGAGTAATATGAATCAGATTATACAGTI-5 A THAT A) Draw boxes around the two promoter elements, centered at - 10 and -35, relative to the start site of transcription. B) Transcription starts at the A-T base pair, which is indicated by the bold letters in the DNA shown above. Based on the asymmetric promoter sequence, RNAP selects one strand as...
can someone help explain part b 4. Transcription. The DNA below contains a promoter sequence recognized...
can someone help explain part b
4. Transcription. The DNA below contains a promoter sequence recognized by E. coli RNA polymerase (KNAP): 5'-AACGTAACTGAATTCCGCAATGGCATGGCATTGCTCATTATACTTAGTCTAATATGTCAA-3 3'-TTGCATTGACTTAAGGCGTTACCGTACCGTAACGAGTAATATGAATCAGATTATACAGTT-5'. A) B) Draw boxes around the two promoter elements, centered at -10 and -35. relative to the start site of transcription Transcription starts at the A-T base pair, which is indicated by the bold letters in the DNA shown above. Based on the asymmetric promoter sequence, RNAP selects one strand as the template for RNA synthesis....
on and 6. Draw the same Eukaryotic transcript after splicing has removed the m label the...
on and 6. Draw the same Eukaryotic transcript after splicing has removed the m label the remaining parts. 7. Describe the roles of the following features involved in Eukaryotic transcription: TATA Binding Protein General Transcription Factors Polymerase II 8. In Eukaryotic transcription, which happens first? A. The General Transcription Factors are recruited, and the Preinitiation complex (PIC) is assembled. B. The TBP binds the promoter 9. Describe the carboxy terminal domain (CTD) of RNA polymerase II and two of its...
Describe how to control transcriptional initiation occurs in both PROKARYOTES and EUKARYOTES. Word bank: promoter TATA-Binding...
Describe how to control transcriptional initiation occurs in both PROKARYOTES and EUKARYOTES. Word bank: promoter TATA-Binding Protein (TBP) RNA polymerase + sigma factor enhancer TATA-box gene-specific transcription factors RNA polymerase + GTFs phosphodiester bonds -10 and -35 consensus sequences mediator protein +1 Transcriptional Start Site (TSS) deoxynucleoside triphosphates (dNTPs) template DNA RNA transcript.
There are several possible mutations in the trp operon: trpP -is a mutation in the promoter...
There are several possible mutations in the trp operon:
trpP -is a mutation in the promoter sequence
that prevents RNA polymerase from binding to the promoter and
initiate transcription of the trp operon genes.
trpOcis a mutation in the operator sequence
that prevents the trp repressor protein from binding to
the operator to block transcription of the trp operon
genes.
trpR-is a mutation in the repressor protein
that either prevents repressor protein from being made or produces
a mutant repressor...
2. a) Sketch a eukaryotic gene (brns) that is regulated by one transcription factor - Brt...
2. a) Sketch a eukaryotic gene (brns) that is regulated by one transcription factor - Brt - that bind 50 bps upstream of the transcription start site and an enhancer - Ned - that binds 10 kb upstream of the transcription start site. In your sketch, indicate the start of transcription, TATA box beginning of the open reading frame for your gene (ATG), location of the promoter, location of the transcription factors, location of the RNA polymerase II, location of...
Question 1 Match the term with the best definition or description; most topics relate to the...
Question 1 Match the term with the best definition or description; most topics relate to the regulation of gene expression. General type of protein which will increase transcription rates when it attaches to a site A. Factor connected to a particular gene - B. Co-repressor C. Enhancer D. Promoter E. Structural F. Intron G. Activator H. Operator I. Basal transcription J. Glucocorticoid receptor K. Sigma factor L. Mediator M. Inducer N. TATA box O. Repressor The rates of mRNA produced...
QUESTION 1 QUESTION 5 QUESTION 11 Identify the components required for translation initiation in bacteria What...
QUESTION 1 QUESTION 5 QUESTION 11 Identify the components required for translation initiation in bacteria What is the enzymatic component of the ribosome? A Protein Identify the TRANS components of the transcription initiation complex in bacteria ATFIE Bir RNA C. TATA BOX D-10 and 35 sequences E Signa factor B. Carbohydrates C.RNA CATFIE B. 5methyl guanosine cap C. Shine-Dalgamo Sequence D. Sigma factor CETFIID (TBP and TAFS) FTFIIB G. Initiator RNA H.10 and 35 sequences EL Smal ribosomal subunit J....
Uluruunu us RJ15 1. Draw or describe the process of eukaryotic transcription and translation, using the...
Uluruunu us RJ15 1. Draw or describe the process of eukaryotic transcription and translation, using the following terms as needed (not all terms will be used): sigma factor, RNA polymerase, DNA polymerase, origin of replication, ribosome, start codon, transcriptional start site, stop codon, nucleus, -10 and -35 sequences, TATA box, TBP, inducer, transcriptional stop site, Shine-Delgrano sequence, Kozak sequence, RNA splicing. 2. Draw or describe the process of prokaryotic/eubacterial transcription and translation, using as many of the terms above as...
Which of the following is not an RNA sequence that is recognized by the spliceosome during...
Which of the following is not an RNA sequence that is recognized by the spliceosome during the process of splicing? O A. The 5' splice site OB. The 3' splice site o C. The promoter OD. The branch point O E. All of the above are recognized by the spliceosome What is the role of the Shine-Dalgarno sequence near the 5' end of prokaryotic mRNAS? O A. It is the sequence recognized by IF-2 OB. It establishes the position of...
please explain a and b
shkaryote 4. Transcription. The DNA below contains a promoter sequence recognized by E. coli RNA polymerase (NAF) TOUCA s. 5'-AACGTAACTGAATTCCGCAATGGCATGGCATTGCTCATTATACTTAGTCTAATATGTCAA-3' 3'-TTGCATTGACTTAAGGCGTTACCGTACCGTAACGAGTAATATGAATCAGATTATACAGTI-5 A THAT A) Draw boxes around the two promoter elements, centered at - 10 and -35, relative to the start site of transcription. B) Transcription starts at the A-T base pair, which is indicated by the bold letters in the DNA shown above. Based on the asymmetric promoter sequence, RNAP selects one strand as...
can someone help explain part b
4. Transcription. The DNA below contains a promoter sequence recognized by E. coli RNA polymerase (KNAP): 5'-AACGTAACTGAATTCCGCAATGGCATGGCATTGCTCATTATACTTAGTCTAATATGTCAA-3 3'-TTGCATTGACTTAAGGCGTTACCGTACCGTAACGAGTAATATGAATCAGATTATACAGTT-5'. A) B) Draw boxes around the two promoter elements, centered at -10 and -35. relative to the start site of transcription Transcription starts at the A-T base pair, which is indicated by the bold letters in the DNA shown above. Based on the asymmetric promoter sequence, RNAP selects one strand as the template for RNA synthesis....
on and 6. Draw the same Eukaryotic transcript after splicing has removed the m label the remaining parts. 7. Describe the roles of the following features involved in Eukaryotic transcription: TATA Binding Protein General Transcription Factors Polymerase II 8. In Eukaryotic transcription, which happens first? A. The General Transcription Factors are recruited, and the Preinitiation complex (PIC) is assembled. B. The TBP binds the promoter 9. Describe the carboxy terminal domain (CTD) of RNA polymerase II and two of its...
There are several possible mutations in the trp operon:
trpP -is a mutation in the promoter sequence
that prevents RNA polymerase from binding to the promoter and
initiate transcription of the trp operon genes.
trpOcis a mutation in the operator sequence
that prevents the trp repressor protein from binding to
the operator to block transcription of the trp operon
genes.
trpR-is a mutation in the repressor protein
that either prevents repressor protein from being made or produces
a mutant repressor...
Question 1 Match the term with the best definition or description; most topics relate to the regulation of gene expression. General type of protein which will increase transcription rates when it attaches to a site A. Factor connected to a particular gene - B. Co-repressor C. Enhancer D. Promoter E. Structural F. Intron G. Activator H. Operator I. Basal transcription J. Glucocorticoid receptor K. Sigma factor L. Mediator M. Inducer N. TATA box O. Repressor The rates of mRNA produced...
QUESTION 1 QUESTION 5 QUESTION 11 Identify the components required for translation initiation in bacteria What is the enzymatic component of the ribosome? A Protein Identify the TRANS components of the transcription initiation complex in bacteria ATFIE Bir RNA C. TATA BOX D-10 and 35 sequences E Signa factor B. Carbohydrates C.RNA CATFIE B. 5methyl guanosine cap C. Shine-Dalgamo Sequence D. Sigma factor CETFIID (TBP and TAFS) FTFIIB G. Initiator RNA H.10 and 35 sequences EL Smal ribosomal subunit J....
Uluruunu us RJ15 1. Draw or describe the process of eukaryotic transcription and translation, using the following terms as needed (not all terms will be used): sigma factor, RNA polymerase, DNA polymerase, origin of replication, ribosome, start codon, transcriptional start site, stop codon, nucleus, -10 and -35 sequences, TATA box, TBP, inducer, transcriptional stop site, Shine-Delgrano sequence, Kozak sequence, RNA splicing. 2. Draw or describe the process of prokaryotic/eubacterial transcription and translation, using as many of the terms above as...
Which of the following is not an RNA sequence that is recognized by the spliceosome during the process of splicing? O A. The 5' splice site OB. The 3' splice site o C. The promoter OD. The branch point O E. All of the above are recognized by the spliceosome What is the role of the Shine-Dalgarno sequence near the 5' end of prokaryotic mRNAS? O A. It is the sequence recognized by IF-2 OB. It establishes the position of...
Most questions answered within 3 hours.
-
i
need the summary of this article “Why I Don’t Trust The Video Games
Cause Violence”...
asked 15 minutes ago -
Draw the reactants and products of the following
reaction:
3-ethyl-2-heptene + HOH → 3-ethyl-3-heptanol +
3-ethyl-2-heptanol...
asked 13 minutes ago -
Determine the ratio of adipic acid and butylene glycol that
should be used to obtain a...
asked 22 minutes ago -
Calculate the ratio of the resistance of 11.0 m of aluminum wire
2.5 mm in diameter,...
asked 15 minutes ago -
Kinkaid Co. is incorporated at the beginning of this year and
engages in a number of...
asked 19 minutes ago -
when setting up a simple pendulum, calculate the string length
required for the period to equal...
asked 38 minutes ago -
: A small but very close dense mass of 389 kg is brought close
to a...
asked 38 minutes ago -
Create a class called Hotel. The hotel class will track the
current reservations for your one-room...
asked 1 hour ago -
In space, a 4.0 kg metal ball moving 30 m/s has a head on
collision with...
asked 1 hour ago -
Financial Markets and Corporate Strategy (assignment template) –
1 of 2
Insights/Instructions: Use this template to...
asked 1 hour ago -
A firm has announced a cash dividend of $3 dollar per share.
Assuming an efficient market,...
asked 1 hour ago -
Which of the following statements is consistent with the fact
that capital in an economy is...
asked 1 hour ago