Ans) The number of hydrogen bonds present are 16 and number of phosphodiester bonds present are 10.
So, option 1 is correct.
Explanation :
The number of hydrogen bonds between G and C are 3 and between A and T are 2. There are 4 GC pairs and 2 AT pairs.
So, number of hydrogen bonds between G and C pairs are 4 X 3 = 12 bonds
and number of hydrogen bonds between A and T pairs are 2 X 2 = 4 bonds
Therefore, total hydrogen bonds present in 5'- CAGCTG-3' are 12 + 4 = 16 bonds.
3'- GTCGAC-5'
1 Phosphodiester bond is present between two nucleotide bases. So, number of phosphodiester bonds present in one strand 5'- CAGCTG-3' are 5 ( between C and A, A and G, G and C, C and T, T and G) and in the other stand 3'- GTCGAC-5' are 5 ( between G and T, T and C , C and G, G and A, A and C).
So, total 10 phosphodiester bonds are present.
Determine the number of hydrogen and phosphodiester bonds present in the following DNA fragment: 5-CAGCTG-3 3-GTCGAC-5...
Question 2 (1 point) 5'-TTAGGG-3' 3'-AATCCC-5' In this sequence, how many hydrogen bonds and phosphodiester bonds are present? O 15,10 O 12,5 O 15.5 O 12,10
8. Answer the following DNA sequences: Given the DNA sequence: 3’-CATCGAATGCAGGTT-5’ 5’-GTAGCTTACGTCCAA-3’ What is the total number of hydrogen bonds between the bases? (Use a numerical answer, no words or units.) Given the DNA sequence: 3’-CATCGAATGCAGGTT-5’ 5’-GTAGCTTACGTCCAA-3’ What is the total number of phosphodiester bonds? (Use a numerical answer, no words or units.)
help plz DNA ligase: Creates 3-5 phosphodiester bonds Has sequence specificity in the same manner as restriction endonucleases O is only used for cloning Will only act on "sticky ends" Next Page Page 28
8. Draw chemical structure of a double strand DNA molecule of following DNA template S'CT3. Include the phosphodiester and all hydrogen bonds. (7) 9. If you cut the following double stranded DNA fragment with a restriction enzyme with restriction site of 5'GAATTC 3" and the cutting point between A and G. Draw the structure of resulting fragments. Specify and name the end of the fragments. (8) 5" ACCTTGTGAATTCTAGGCAT3 3' TGGAACACTTAAGATCCGTAS
DNA containing broken phosphodiester bonds ("nicks") can be repaired by the action of a ligase enzyme. Formation of a new phosphodiester bond in DNA requires the free energy of ATP, which is hydrolyzed to AMP: ligase ATP + nicked bond - AMP + PP, + phosphodiester bond The equilibrium constant expression for this reaction can be rearranged to define a constant, C, as follows: K [phosphodiester bond][AMPUPP1 [nick][ATP] [nick] [AMP][PP:1 [phosphodiester bond] Keq[ATP] [PP1 Keq[ATP] [nick] = C[AMP) [phosphodiester bond]...
What is the total number of hydrogen bonds that exist between the DNA strand 5'-TTCAGAG-3' and its complementary bond?
24. Label phosphodiester bonds and nucleotides in the following structure. DNA O- opo HA 8 에 25. Describe Watson-Crick model of DNA structure. 27. What is the in for a double-stranded DNA? How does it qualitatively depend in its nucleotide composition?
How many hydrogen bonds exist between this DNA strand and its complementary strand? 5′–GCTCACG–3′ number of hydrogen bonds between strands: ?
How many hydrogen bonds exist between this DNA strand and its complementary strand? 5′–TCGGGCG–3′ number of hydrogen bonds between strands:
How many hydrogen bonds exist between this DNA strand and its complementary strand? 5'-CCAACGT-3 number of hydrogen bonds between strands: 19