8. Answer the following DNA sequences: Given the DNA sequence: 3’-CATCGAATGCAGGTT-5’ 5’-GTAGCTTACGTCCAA-3’ What is the total...
8. Answer the following DNA sequences:
Given the DNA sequence:
3’-CATCGAATGCAGGTT-5’ 5’-GTAGCTTACGTCCAA-3’ What is the total number of hydrogen bonds between the bases? (Use a numerical answer, no words or units.)
Given the DNA sequence:
3’-CATCGAATGCAGGTT-5’ 5’-GTAGCTTACGTCCAA-3’ What is the total number of phosphodiester bonds? (Use a numerical answer, no words or units.)
Homework Answers
8. Q1. 37
Q2. 28.
Add Answer to:
8. Answer the following DNA sequences:
Given the DNA sequence:
3’-CATCGAATGCAGGTT-5’ 5’-GTAGCTTACGTCCAA-3’ What is the total...
Determine the number of hydrogen and phosphodiester bonds present in the following DNA fragment: 5-CAGCTG-3 3-GTCGAC-5...
Determine the number of hydrogen and phosphodiester bonds present in the following DNA fragment: 5-CAGCTG-3 3-GTCGAC-5 hydrogen bonds= 16; phosphodiester bonds= 10 hydrogen bonds=14; phosphodiester bonds=5 O hydrogen bonds= 10; phosphodiester bonds= 5 hydrogen bonds= 12; phosphodiester bonds-6
Use the following DNA sequence as the template strand to answer these questions. (8 points) 5’-...
Use the following DNA sequence as the template strand to answer these questions. (8 points) 5’- GAT CCT GCC TAA -3’ Draw the non-template DNA sequence, the mRNA sequence and the resulting peptide. Label the terminus of the DNA and peptide!! Draw a point mutation. Is this a transition mutation or transverse mutation? Did it change the amino acid sequence(draw out the peptide)? 4 bp insertion, and the resulting peptide. 2 bp deletion, and the resulting peptide. A copy number...
If the sequence of the 5'-3'DNA strand is AATGCTAC, then the complementary DNA sequence has the...
If the sequence of the 5'-3'DNA strand is AATGCTAC, then the complementary DNA sequence has the following sequence o 3-AATGCTAC-5' 3'-CATCGTAA-5 3-GTAGCATT-5 3-TTACGATG-5 Question 2 20 pts Which of the following does the enzyme primase make? phosphodiester linkages (bonds) Okazaki fragments RNA primer DNA primer In which direction does DNA replication take place? 3'to 5 5'to 5 5'to 3 3'to 3 Question 4 20 pts Which enzyme unwinds the double-stranded helical DNA starting at the origin of replication? ligase primase...
Identify two restriction endonucleases that could be used to make sticky ends near the 5’ end of this DNA sequence (uppe...
Identify two restriction
endonucleases that could be used to make sticky ends near the
5’ end of this DNA sequence (upper strand) so that
it could be incorporated into a new plasmid. You have a short list
of them in Table 9-2, and the specific, short sequences of bases
that other enzymes cut at are easily obtained from web resources.
You must cut as near to the 5' end as possible. Indicate the
specific sequences of bases for each endonuclease...
3' Given below are the complimentary strands of DNA with the genetic sequences: DNA 5' STRAND...
3' Given below are the complimentary strands of DNA with the genetic sequences: DNA 5' STRAND = = = = = = = = = = = = = = > TG A G C T A C CAC T T T A A c T C G AT GGT GAA AT DNA 3' STRAND < = = = = = = = = = = = = = = 5 A. In the following spaces, fill in the blanks...
8. Draw chemical structure of a double strand DNA molecule of following DNA template S'CT3. Include...
8. Draw chemical structure of a double strand DNA molecule of following DNA template S'CT3. Include the phosphodiester and all hydrogen bonds. (7) 9. If you cut the following double stranded DNA fragment with a restriction enzyme with restriction site of 5'GAATTC 3" and the cutting point between A and G. Draw the structure of resulting fragments. Specify and name the end of the fragments. (8) 5" ACCTTGTGAATTCTAGGCAT3 3' TGGAACACTTAAGATCCGTAS
Below is a diagram of a section of a DNA molecule. Answer the question based on...
Below is a diagram of a section of a DNA molecule. Answer the
question based on the diagram. Here are the answers for
questions.
3' end of strand
5' end of strand
deoxyribose sugar
ribose sugar
hydrogen bonds between nitrogenous bases
phosphodiester bond containing phosphate group
purine bases
pyrimidine bases.
A indicates -
B indicates -
C indicates -
D indicates -
E indicates -
G indicates -
H indicates -
сн. о. он,С, А1 т он,с.
What is the total number of hydrogen bonds that exist between the DNA strand 5'-TTCAGAG-3' and...
What is the total number of hydrogen bonds that exist between the DNA strand 5'-TTCAGAG-3' and its complementary bond?
One strand of a DNA sequences is given below. Find the EcoRI sites and indicate the...
One strand of a DNA sequences is given below. Find the
EcoRI sites and indicate the cutting site with an arrow. Count the
number of bases in each fragment.
CP22: vne strand of a DNA sequence is given below. Find the EcoRI sites and indicate the cutting site with an arrow. Count the number of bases in each fragment. Restriction digest A: ATTGAATTCCGGTTAGCTTTAGAATTCCGCCATATGCGCAATTGGAATTCC Number of bases in each fragment: Now compare the same region of DNA from another individual. Where...
Below are several DNA sequences that are mutated compared with the wild-type sequence: 3-TAC TGACTGACGAT C-5....
Below are several DNA sequences that are mutated compared with the wild-type sequence: 3-TAC TGACTGACGAT C-5. Envision that each is a section of a DNA molecule that has separated in preparation for transcription, so you are only seeing the template strand. Construct the complementary DNA sequences (indicating 5' and 3' ends) for each mutated DNA sequence, then transcribe (indicating 5' and 3' ends) the template strands, and translate the mRNA molecules using the genetic code, recording the resulting amino acid...
Determine the number of hydrogen and phosphodiester bonds present in the following DNA fragment: 5-CAGCTG-3 3-GTCGAC-5 hydrogen bonds= 16; phosphodiester bonds= 10 hydrogen bonds=14; phosphodiester bonds=5 O hydrogen bonds= 10; phosphodiester bonds= 5 hydrogen bonds= 12; phosphodiester bonds-6
If the sequence of the 5'-3'DNA strand is AATGCTAC, then the complementary DNA sequence has the following sequence o 3-AATGCTAC-5' 3'-CATCGTAA-5 3-GTAGCATT-5 3-TTACGATG-5 Question 2 20 pts Which of the following does the enzyme primase make? phosphodiester linkages (bonds) Okazaki fragments RNA primer DNA primer In which direction does DNA replication take place? 3'to 5 5'to 5 5'to 3 3'to 3 Question 4 20 pts Which enzyme unwinds the double-stranded helical DNA starting at the origin of replication? ligase primase...
Identify two restriction
endonucleases that could be used to make sticky ends near the
5’ end of this DNA sequence (upper strand) so that
it could be incorporated into a new plasmid. You have a short list
of them in Table 9-2, and the specific, short sequences of bases
that other enzymes cut at are easily obtained from web resources.
You must cut as near to the 5' end as possible. Indicate the
specific sequences of bases for each endonuclease...
3' Given below are the complimentary strands of DNA with the genetic sequences: DNA 5' STRAND = = = = = = = = = = = = = = > TG A G C T A C CAC T T T A A c T C G AT GGT GAA AT DNA 3' STRAND < = = = = = = = = = = = = = = 5 A. In the following spaces, fill in the blanks...
8. Draw chemical structure of a double strand DNA molecule of following DNA template S'CT3. Include the phosphodiester and all hydrogen bonds. (7) 9. If you cut the following double stranded DNA fragment with a restriction enzyme with restriction site of 5'GAATTC 3" and the cutting point between A and G. Draw the structure of resulting fragments. Specify and name the end of the fragments. (8) 5" ACCTTGTGAATTCTAGGCAT3 3' TGGAACACTTAAGATCCGTAS
Below is a diagram of a section of a DNA molecule. Answer the
question based on the diagram. Here are the answers for
questions.
3' end of strand
5' end of strand
deoxyribose sugar
ribose sugar
hydrogen bonds between nitrogenous bases
phosphodiester bond containing phosphate group
purine bases
pyrimidine bases.
A indicates -
B indicates -
C indicates -
D indicates -
E indicates -
G indicates -
H indicates -
сн. о. он,С, А1 т он,с.
One strand of a DNA sequences is given below. Find the
EcoRI sites and indicate the cutting site with an arrow. Count the
number of bases in each fragment.
CP22: vne strand of a DNA sequence is given below. Find the EcoRI sites and indicate the cutting site with an arrow. Count the number of bases in each fragment. Restriction digest A: ATTGAATTCCGGTTAGCTTTAGAATTCCGCCATATGCGCAATTGGAATTCC Number of bases in each fragment: Now compare the same region of DNA from another individual. Where...
Below are several DNA sequences that are mutated compared with the wild-type sequence: 3-TAC TGACTGACGAT C-5. Envision that each is a section of a DNA molecule that has separated in preparation for transcription, so you are only seeing the template strand. Construct the complementary DNA sequences (indicating 5' and 3' ends) for each mutated DNA sequence, then transcribe (indicating 5' and 3' ends) the template strands, and translate the mRNA molecules using the genetic code, recording the resulting amino acid...
Most questions answered within 3 hours.
-
A car starts from rest on a curve with a radius of 150 m and
tangential...
asked 41 minutes ago -
In Star Wars both the Storm Troopers and Droid Army are
notoriously bad shots. In order...
asked 3 hours ago -
when buffers react with h+ or oh-, do the ratio of conjugate
base to acid and...
asked 3 hours ago -
A population of values has a normal distribution with μ=207.3
and σ=35.8. A random sample of...
asked 4 hours ago -
An unknown solution was treated with H2SO4 and refluxed for 2
hours. The mixture was then...
asked 4 hours ago -
Let x be the age of a licensed driver in years. Let
y be the percentage...
asked 5 hours ago -
System.out.print( "Barrel\t"+"of"+"Laughs" );
asked 5 hours ago -
Need a 1,000 word self explanatory essay on how
characteristics of the functional, matrix & bureaucracy...
asked 5 hours ago -
(Could you explain how I can answer the question and what the
equation I will use)....
asked 5 hours ago -
The ΔGf0 values for HCO3- (aq),
CO32-(aq), and H+(aq) are -587.06,
-528.10 and 0 kJ mol-1,...
asked 5 hours ago -
Southeast Soda Pop, Inc., has a new
fruit drink for which it has high hopes. John...
asked 5 hours ago -
Time (s)
Position (m)
0
0
1
3
2
8
3
15
An object travels along...
asked 5 hours ago