A nucleotide is composed of a nitrogenous base, deoxyribose sugar, and phosphate group.
Phosphodiester bond is formed between two sugar via a phosphate group. The bond is between sugar- phosphate- sugar, this forms the backbone of DNA.
Please give a thumbs up!!!!!!!! Ask any doubts regarding the above question in the comment section !!!!!!!!!!! Thank you!!!!!
24. Label phosphodiester bonds and nucleotides in the following structure. DNA O- opo HA 8 에...
O -O 25. Describe Watson-Crick model of DNA structure. 26. Which of the following statements about "Chargaff's rules" is false: A) The base composition of DNA generally varies from one species to another. B) DNA specimens isolated from different tissues of the same species have the same base composition. C) The base composition of DNA in a given species does not change with an organism's age, nutritional state, or changing environment. D) In all cellular DNAs, regardless of the species,...
please answer all parts
3. (a) The following structure is a nucleotide found in human. HO-P-O он о No ОН ОН I. There are two types of nitrogenous bases. Which type is it in this nucleotide? (1 mark) ii. Can this nucleotide be found in DNA or RNA? Explain. marks) iii. Give the name of this nucleotide. marks) (b) The following diagram shows the chemical structure of double-stranded DNA. Label the 5' and 3' ends on each strand. marks) Indicate...
8. Draw chemical structure of a double strand DNA molecule of following DNA template S'CT3. Include the phosphodiester and all hydrogen bonds. (7) 9. If you cut the following double stranded DNA fragment with a restriction enzyme with restriction site of 5'GAATTC 3" and the cutting point between A and G. Draw the structure of resulting fragments. Specify and name the end of the fragments. (8) 5" ACCTTGTGAATTCTAGGCAT3 3' TGGAACACTTAAGATCCGTAS
The following diagram shows the chemical structure of double-stranded DNA. 0- i. ii. Label the 5' and 3' ends on each strand. Indicate with an arrow the hydrogen bonds in the structure above. (4 marks) (1 mark) (a) Name the bonding between the adjacent nucleotides on a DNA strand, and (b) give the total number of this bonding in the structure above? (2 marks)
DNA is formed by building blocks called __________. nucleotides nitrogenous bases polypeptides deoxyribose 0.5 points QUESTION 2 What does DNA stand for? Double-stranded Nucleic Acid Ribonucleic acid Deoxyribonucleic Acid Double-helix Nucleic Acid 0.5 points QUESTION 3 The nucleotides of DNA are held together by ___________. ionic bond hydrogen bond phosphodiester bond sugar-phosphate backbone 0.5 points QUESTION 4 DNA nucleotides with one-carbon nitrogen ring bases are called ________. adenines purines pyrimidines guanines 0.5 points QUESTION 5 Basic...
Each of the following statements about the structure of DNA may be either true or false. Choose the appropriate answer for each of these statements. Bonding between adenine and thymine on opposite strands involves two hydrogen bonds. Nitrogenous bases are located on the outside of the double helix: phosphates are located towards the middle of the double helix. Bonding between guanine and cytosine on opposite strands involves three hydrogen bonds. DNA and RNA are structurally different due to the difference...
14.2 Modeling the Structure and Function of Nucleic Acids and Their Products 2. The following diagram represents some of the puzzle piece pieces used in this section. a Assembled in this form, do they represent an amino acid, c. a portion of messenger RNA, or a deoxyribonucleotide (b) Explain your answer. Opo 3. Why is DNA often called a double helix? 4. State the following ratios. (a) Guanine to cytosine in a double-stranded DNA molecule: (b) Adenine to thymine: -...
24. What would be the anticodon if the template strand of DNA Is ACC A UCC B.) TGG UGG D. ACC E. TCC 25. Prior to protein synthesis, the DNA A. attracts tRNAs with appropriate amino acids. 6.) serves as a template for the production of mRNA. C. adheres to ribosomes for protein synthesis. D. contains anticodons that become codons. E. must first undergo replication. 26. The Human Genome Project has revealed that human DNA has approximately A. 30,000 bases...
8. In which one of the following cellular processes is DNA involved? (Select all that apply.) DNA replication transcription translation transcription and translation 10. Dogs have lots of fur that they need to keep warm during winter months. However, this makes them prone to overheating during summer months. Luckily, dogs are commonly observed "panting," which is a method used by dogs to exchange hot air for cool air thereby decreasing their temperature. What qualification life would BEST explain this? reproduction...
25. Mendel's factors undergo segregation and independent assortment. How is this illustrated in the chromosomes during Meiosis I? 26. Explain how these inheritance patterns are considered non-Mendelian. Incomplete Dominance . Multiple Alleles • Codominance X-linked Linkage . Pedigrees - Genetic Disorders 27. What is non-disjunction and how does it affect the chromosome distribution during meiosis? 28. What is a karyotype and what does it allow you to do? 29. Fill in the circles and squares to illustrate the following inheritance...