5' end is found at the free phosphate molecule in the DNA. The 3' end found at free hydroxyl group.
Please look in the image for solution:
The following diagram shows the chemical structure of double-stranded DNA. 0- i. ii. Label the 5'...
please answer all parts 3. (a) The following structure is a nucleotide found in human. HO-P-O он о No ОН ОН I. There are two types of nitrogenous bases. Which type is it in this nucleotide? (1 mark) ii. Can this nucleotide be found in DNA or RNA? Explain. marks) iii. Give the name of this nucleotide. marks) (b) The following diagram shows the chemical structure of double-stranded DNA. Label the 5' and 3' ends on each strand. marks) Indicate...
8. Draw chemical structure of a double strand DNA molecule of following DNA template S'CT3. Include the phosphodiester and all hydrogen bonds. (7) 9. If you cut the following double stranded DNA fragment with a restriction enzyme with restriction site of 5'GAATTC 3" and the cutting point between A and G. Draw the structure of resulting fragments. Specify and name the end of the fragments. (8) 5" ACCTTGTGAATTCTAGGCAT3 3' TGGAACACTTAAGATCCGTAS
3. Shown below is a double stranded DNA. Replicate this DNA fragment and show the products formed from this replication. Remember, in replication, each strand is copied into a new daughter strand. In your answer, indicate which strands are the new daughter strands (mark with D) and which strands are the already existing parent strands (mark with P as shown below). Label the 5’ and 3’ ends of all DNA. HINT: You should have 2 double-stranded DNA fragments after replication....
Part A Which model shows the correct polarity of double-stranded DNA? Which model shows the correct polarity of double-stranded DNA? Part B Which model shows the correct polarity between mRNA and the DNA template during transcription? Which model shows the correct polarity between mRNA and the DNA template during transcription? Part C Which model shows the correct polarity between mRNA and tRNA during translation? Which model shows the correct polarity between mRNA and tRNA during translation? Part D Interpret this...
A segment of a double-stranded DNA molecule is shown below. The start of a gene is indicated as the +1 base pair: + 1 5'TATATTTTCTATATGCACATTTGCAAGTAA 3'(strand A) 3'ATATAAAAGATATACGTGTAAACGTTCATT 5'(strand B) Uparrow (A) If RNA polymerase moves along this DNA from left to right, indicate the position of the promoter region on this DNA and indicate which strand is the template strand (B) Write the complete mRNA that would be transcribed from the gene above, again being sure to label the...
The following figure shows a simplified diagram of part of a DNA molecule. a. Identify the parts of the DNA molecule labelled A to C in the figure above. (3 marks) b. The table below shows the results of an analysis of the base composition for each strand of a DNA molecule. Complete the table by adding the missing values for strands 1 and 2. (5 marks) Percentage of each base DNA strand А Тc TG Strand 1 3522 Strand...
Part C this is for Genetics UUUUUUUUUUUUUUPPO 1 (UU (AA (CA 44. A double-stranded DNA molecule with the sequence shown here produces, in vivo, a polypeptide that is five amino acids long. TACATGATCATTTCACGGAATTTCTAGCATGTA ATGTACTAGTAAAGTGCCTTAAAGATCGTACAT (UA (AL a. Which strand of DNA is the template strand, and in which direction is it transcribed? b. Label the 5' and the 3' ends of each strand. c. If an inversion occurs between the second and the third triplets from the left and right...
24. Label phosphodiester bonds and nucleotides in the following structure. DNA O- opo HA 8 에 25. Describe Watson-Crick model of DNA structure. 27. What is the in for a double-stranded DNA? How does it qualitatively depend in its nucleotide composition?
6. A double-stranded DNA molecule with the sequence shown here produces a polypeptide that is 5 amino acids long. The sequence does not include the promoter. Transcription is proceeding left to right(). thlt TEAM 3' ATGradGGCTAAAGTGCCATCTAAAGATCGTACAT 5' loding 5' TACATGCCGATTTCACGCTAGATTTCTAGCATGTA 3' shar a. Label the template and coding strands. b. In the template strand, underline the nucleotides that will encode the start codon. c. The stop codon for the polypeptide is (UAA (UAG UGA).(circle the correct answer) d. In the...
Draw the chemical structure of the DNA trimer 5’-ACG-3’ hydrogen-bonded to its complementary strand. Include the deoxyribose rings and the phosphodiester backbones and show the H-bonding interactions between the bases.