a) this mutation is due to the insertion of C before, after or in between 9-10 bases ( since both 9 and 10 th bases are C we cannot exactly pinpoint where insertion happened) due to the insertion reading frame of the gene is changed so this is frameshift mutation.
b) here it is asked to write codon of the in the translated portion of mRNA, the First codon which is translated is AUG which codes for methionine
so for normal gene mRNA (the region which is translated is the region between the start codon and stop codon)
5`- AUG CCG UAC UGC CAG CUA ACU GCU AAA GAA CAA UUA-3`
mutant gene
5`- AUG CCC GUA CUG CCA GCU AAC UGC UAA-3`
c) normal-
N- Met- Pro- Tyr-Cys-Gln-Leu-Thr- Ala-Lys-Glu-Gln-Leu
mutant- N- Met-Pro-Val-Leu-Pro-Ala-Asn-Cys-C
Im confused with the answer for B. Where did the AUG come from? 13.31 Mutations in...
28. What is the amino acid sequence that will be produced from this original DNA sequence: 3' GCATGTACACCTTGGCGACGACTGCTTA 5' a. Met - Tyr - Asn - Thr - Leu - Ala - Thr-Thr - Ala b. Met - Trp -Asn-Arg - Cys C. Ala-Lys - Thr-Pro-Gly - Asp - Asp - Cys d. Arg - Thr-Cys - Gly-Pro-Leu-Leu - Thr - Asn e. None of the above Using the original DNA OG the new mutat
Some amino acids are post-translationally removed from the C-terminal end of the beta-lactamase enzyme from B. imaginarium (i.e. - after it is translated and released from the ribosome, a protease chews off a some amino acids). The wild-type enzyme, which has had the amino acids removed from the C’-terminus, is 246 amino acids in length and the C-terminal amino acids are shown below aligned with the C-terminal amino acids of a frameshift mutant, which – due to a frameshift mutation -...
The next DNA sequence is the MATRICE strand of a small gene. What is the complete amino acid sequence of the encoded peptide? GTCATGGCAACATAG 5'-3 Standard Genetic Code First position (5'end) U Second position UAU Tyr UAC Tyr UCA Ser UAA StopUGA Stop UAG Stop UUU Phe UUC Phe UUA Leu UUG Leu UGU Cys UGC Cys UCU Ser UCC Ser UCG Ser UGG Trp CUU Leu CUC Leu CUA Leu CUG Leu CCU Pro CCC Pro CCA Pr CCG...
2. On the mRNA codon table, the first nucleotide in mRNA is to the left, the second is above, and third is to the right. On the sequence, the 5'cap is indicated by (5'). The poly (A) tail is not shown. Use the codon table to translate this short mRNA. Mark the codons and write the amino acid sequence beneath them. (5') CGUUACAAUGUAUCGCGCGGUACUCGGCAAAGUGCCCUGAAUAGAGUUGGUA (3') 3. DNA polymerase made a mistake and added a C on the DNA template strand. In...
Did I answer the mRNA sequences and Amino acid sequences correctly? What types of mutations are these? How do you do the bottom? Part 3. Cystic Fibrosis Directions: Cystic Fibrosis is a disorder where the individuals have long and kidney problems. The disorder is caused by a mutation in one of the individual's genes. Complete the boxes below by finding the mRNA and amino acid sequence Compare the moutant DNA strands to the original strand. Circle the mutation in the...
Some amino acids are post-translationally removed from the C-terminal end of the beta-lactamase enzyme from B. imaginarium (i.e. - after it is translated and released from the ribosome, a protease chews off some amino acids). The wild-type enzyme, which has had the amino acids removed from the C’-terminus, is 246 amino acids in length and the C-terminal amino acids are shown below aligned with the C-terminal amino acids of a frameshift mutant, which – due to a frameshift mutation - is...
Some amino acids are post-translationally removed from the C-terminal end of the beta-lactamase enzyme from B. imaginarium (i.e. - after it is translated and released from the ribosome, a protease chews off some amino acids). The wild-type enzyme, which has had the amino acids removed from the C’-terminus, is 246 amino acids in length and the C-terminal amino acids are shown below aligned with the C-terminal amino acids of a frameshift mutant, which – due to a frameshift mutation - is...
20. This sequence is RNA because:A) it is single stranded.B) it contains U (uracil) and no T (thymine).C) it runs in a 5' to 3' direction.D) it codes for amino acids.E) it is a small molecule.21. Which amino acids does this sequence code for, if the reading frame is as shown, starting from the correct end? A) gly-ala-arg-cys-ile...B) pro-arg-ala-thr-stopC) met-asn-glu-leu...D) glu-leu-val-val-phe...E) leu-glu-gln-his-asn...22. If the sequence gets changed to 5' ... GGAGACUCGUUGUAUU... 3'. What would be the effect on the amino...
i think there are two right answers? From the partial nucleotide sequence given below, what peptides could be encoded? 5-GCCUCCAAAccccucCA-3' Choose one or more: A. Ala-Ser-Lys-Pro-Leu B. Leu-Gln-Thr-Pro-Pro C. Pro-Pro-Asn-Pro-Ser D. Lys-Pro-Ser-Gly-Met E. Met-Arg-His-Asp-Pro From the partial nucleotide sequence given below, what peptides could be encoded? 5-GCCUCCAAAccccucCA-3' Choose one or more: A. Ala-Ser-Lys-Pro-Leu B. Leu-Gln-Thr-Pro-Pro C. Pro-Pro-Asn-Pro-Ser D. Lys-Pro-Ser-Gly-Met E. Met-Arg-His-Asp-Pro
What amino acid would the Manticodon code for RNA codon table 2nd position Tot position СТА Tyr Phe Phe > eu eu Oulaa Jooo 9999 stop stop eu eu eu Let 0 - puchbucobucusura BER < Val Val Asp Ala Asp Ala Glu Ala Glu Amino Acids Keu Pro Pro His Weu Leu Gin lle Pro Thr Thr Thr Thr Asn Asn lle Ser Ser Arg lle Met Lys Lys bucoucouco Arg > Asp Asp Val Val Val Val Ala...