A base pair is two chemical bases bonded to one another forming a "rung of the DNA ladder." The DNA molecule consists of two strands that wind around each other like a twisted ladder. Each strand has a backbone made of alternating sugar (deoxyribose) and phosphate groups. Attached to each sugar is one of four bases--adenine (A), cytosine (C), guanine (G), or thymine (T). The two strands are held together by hydrogen bonds between the bases, with adenine forming a base pair with thymine, and cytosine forming a base pair with guanine.
Each DNA strand has two ends. The 5' end of the DNA is the one with the terminal phosphate group on the 5' carbon of the deoxyribose; the 3' end is the one with a terminal hydroxyl (OH) group on the deoxyribose of the 3' carbon of the deoxyribose.
Here, we have to draw 5'AGTC3' .
Thank you!
8. Draw chemical structure of a double strand DNA molecule of following DNA template S'CT3. Include the phosphodiester and all hydrogen bonds. (7) 9. If you cut the following double stranded DNA fragment with a restriction enzyme with restriction site of 5'GAATTC 3" and the cutting point between A and G. Draw the structure of resulting fragments. Specify and name the end of the fragments. (8) 5" ACCTTGTGAATTCTAGGCAT3 3' TGGAACACTTAAGATCCGTAS
Draw 10 base pair structure of complementary strand DNA
Draw the chemical structure of the DNA trimer 5’-ACG-3’ hydrogen-bonded to its complementary strand. Include the deoxyribose rings and the phosphodiester backbones and show the H-bonding interactions between the bases.
Draw the structure of following compounds 3. Draw the structure of following compounds. 4-Bromo 3- chlorobenzoic acid 4-Chlorobutyl-3-chloro hexanoate Isobutyl acetate MacBook Air esc F1 F2 20 F $ 4 2 3 % 5 & 7 6 & Pentandjoic acid Cyclo propane dicarboxylic aad MacBook Air F2 F3 FS 97 # $
o @ Q Search 4. For the following chemical reactions, draw the transition state structure and predict the sign of ASt for the reaction: Me O + ent. oro Me Meo Y Ome Но + CO2 + 2 MOH c. Draw your own reaction, transition state structure, and predict the sign of ASH
Q:1. Which of the following is the correct structure for the compound (S)-3- methylheptane. - IV -== Q:2. Which of the following is the correct IUPAC name of the following structure? (S)-2-ethylhexane (S)-3-methylheptane (R)-2-ethylhexane (R)-3-methylheptane
Complete the following paragraph to describe the structure of DNA
A. Draw the chemical structure of the GC base pair as found in human DNA. Circle all hydrogen bonds. B. Add the structures of both deoxyribose sugars as they would be linked to the bases in diagram, and diagram both of the four phosphodies adjacent base pairs. your ter linkages between this base pair and
draw a structure for the following compounds compounds: Draw a structure for the following 14-(1,1-Dimethylethyl) – 4-octanal <3 - Chloro-2-(4-hydroxyethyl) -6- nitrophenol ③ 3-(2-Fluoro-2-ProPenyl)-5-hepten-2-one 6 4-(1-methylethyl)-5-methyl-3-hexanal
5 Describe the process of DNA replication; include the following terms: antiparallel structure, DNA Okazaki fragments, DNA ligase, primer, primase, helicase, topoisomerase, single-strand binding proteins. Describe the function of Helicase, Primase, topoisomerase, DNA Polymerase III, DNA Polymerase I, DNA ligase