Draw 10 base pair structure of complementary strand DNA
Draw 10 base pair structure of complementary strand DNA
Homework Answers
Draw the chemical structure of the DNA trimer 5’-ACG-3’ hydrogen-bonded to its complementary strand. Include the...
Draw the chemical structure of the DNA trimer 5’-ACG-3’ hydrogen-bonded to its complementary strand. Include the deoxyribose rings and the phosphodiester backbones and show the H-bonding interactions between the bases.
Please help me to answer this: Give the base sequence of the complementary DNA strand of...
Please help me to answer this: Give the base sequence of the complementary DNA strand of the DNA chain with the following base sequence: 5' ACGTAG 3'
Write the base sequence of the complementary strand... (Please explain! thank you) 8. Base Sequence of...
Write the base sequence of the complementary strand... (Please
explain! thank you)
8. Base Sequence of Complementary DNA Strands Write the base sequence of the complementary strand (from 5' to 3') for the following one strand of a double-helical DNA, and then identify Palindrome sequence(s) or Mirror repeat sequence(s). i) 5'- GCGCAATATTTCTAGAAATATTGCGC - 3' ii) 5'-TTAGCACGTGCTAA-3' iii) 5'-TTAGCACCACGATT-3'
Replicate the DNA strand below and create a complementary strand. Remember that complementary bases will always...
Replicate the DNA strand below and create a complementary strand. Remember that complementary bases will always match with each other Adenine--Thymine and Cytosine--Guanine. AGCCCGTCTTGGAAT
2 [Type text] 3. Using this strand of DNA: AATACCGATACGGGGCAACTAAA a. Create the complementary DNA strand...
2 [Type text] 3. Using this strand of DNA: AATACCGATACGGGGCAACTAAA a. Create the complementary DNA strand (1 pts.) b. Create the complementary mRNA strand (from the original strand) (2 pts) c. Create the protein (refer to Table 1 on page 3 as needed) (2 pts.)
A. Draw the chemical structure of the GC base pair as found in human DNA. Circle...
A. Draw the chemical structure of the GC base pair as found in human DNA. Circle all hydrogen bonds. B. Add the structures of both deoxyribose sugars as they would be linked to the bases in diagram, and diagram both of the four phosphodies adjacent base pairs. your ter linkages between this base pair and
Question 1 1 pts Why is it important for DNA to have complementary base pairing? O...
Question 1 1 pts Why is it important for DNA to have complementary base pairing? O Complementary base pairing allows base pairs to be packed in the most energetically favorable arrangement inside of the double helix structure. O Complementary base pairing will pair a purine with a purine, which are a similar width, thus they are able to hold the sugar-phosphate backbone an equal distance apart along the DNA molecule o Complementary base pairing is only important for maintaining the...
A strand of DNA has the base sequence GATTCA
3. A strand of DNA has the base sequence GATTCA. Write the base sequence for the complementary strand. 5'-G A T T C A-3' 4. List the steps (and the major enzymes in each step) involved in DNA replication: 5. In what direction is a new DNA strand formed?6. Define the following terms: a. Transcription b. Translation: 7. Write the base sequence for the mRNA that would be formed during transcription from the DNA strand with the base sequence 5'-G CCATATTG-3' 8. For each of the following...
Fill in the complementary base pairs for the strand below STACGCCCATTI TAGA ATTGCGTGGGCATTAAGTTTTA TACC3 DNA sequences...
Fill in the complementary base pairs for the strand below STACGCCCATTI TAGA ATTGCGTGGGCATTAAGTTTTA TACC3 DNA sequences 3' I Find and put a square around the TATA box (promoter) in the double stranded DNA above Find and circle the terminator sequence (GGGCG) in one of the strands above The strand with promoter and terminator is the strand of interest: using the template strand, synthesize an mRNA sequence mRNA molecule in the boxes below; pay attention to polarity 53: Find and circle...
What is the complementary strand of the following DNA strand? Drag each label to the appropriate...
What is the complementary strand of the following DNA strand? Drag each label to the appropriate target. Hints
Write the base sequence of the complementary strand... (Please
explain! thank you)
8. Base Sequence of Complementary DNA Strands Write the base sequence of the complementary strand (from 5' to 3') for the following one strand of a double-helical DNA, and then identify Palindrome sequence(s) or Mirror repeat sequence(s). i) 5'- GCGCAATATTTCTAGAAATATTGCGC - 3' ii) 5'-TTAGCACGTGCTAA-3' iii) 5'-TTAGCACCACGATT-3'
2 [Type text] 3. Using this strand of DNA: AATACCGATACGGGGCAACTAAA a. Create the complementary DNA strand (1 pts.) b. Create the complementary mRNA strand (from the original strand) (2 pts) c. Create the protein (refer to Table 1 on page 3 as needed) (2 pts.)
A. Draw the chemical structure of the GC base pair as found in human DNA. Circle all hydrogen bonds. B. Add the structures of both deoxyribose sugars as they would be linked to the bases in diagram, and diagram both of the four phosphodies adjacent base pairs. your ter linkages between this base pair and
Question 1 1 pts Why is it important for DNA to have complementary base pairing? O Complementary base pairing allows base pairs to be packed in the most energetically favorable arrangement inside of the double helix structure. O Complementary base pairing will pair a purine with a purine, which are a similar width, thus they are able to hold the sugar-phosphate backbone an equal distance apart along the DNA molecule o Complementary base pairing is only important for maintaining the...
Fill in the complementary base pairs for the strand below STACGCCCATTI TAGA ATTGCGTGGGCATTAAGTTTTA TACC3 DNA sequences 3' I Find and put a square around the TATA box (promoter) in the double stranded DNA above Find and circle the terminator sequence (GGGCG) in one of the strands above The strand with promoter and terminator is the strand of interest: using the template strand, synthesize an mRNA sequence mRNA molecule in the boxes below; pay attention to polarity 53: Find and circle...
What is the complementary strand of the following DNA strand? Drag each label to the appropriate target. Hints
Most questions answered within 3 hours.
-
Write the overall reaction for the RedOx
reaction (below) when it occurs in an acidic environment....
asked 3 minutes ago -
Two forces are acting on an object. Force 1 on the object is 6.0
N and...
asked 4 minutes ago -
You are planning for retirement. You plan to work for 20 years.
Starting a year from...
asked 17 minutes ago -
The African Adventures exhibit water system holds approximately
850,000 gallons (3.2x109 g) of water. The temperature...
asked 8 minutes ago -
which of the following is capital?
the barn a farmer uses to hold the chickens he...
asked 19 minutes ago -
Attribute
Sample Value
Sample Value
Sample Value
Sample Value
pirate_num
11
22
43
54
pirate_lname
James...
asked 12 minutes ago -
10. Two forces act on a 3 kg object, the gravitational force and
a second, constant...
asked 29 minutes ago -
Dividing Partnership Net Loss
Leigh Meadows and Byron Leef formed a partnership in which the
partnership...
asked 26 minutes ago -
Discuss how Entrepreneurial leadership style differs
from traditional leadership?
asked 52 minutes ago -
A futuristic design for a car is to have a large solid
disk-shaped flywheel within the...
asked 50 minutes ago -
Solid NaOH is added to a solution of 0.50 M acetic acid until
the pH of...
asked 53 minutes ago -
Which of the following statements is not a characteristic of the
Internal Revenue Code?
A) The...
asked 1 hour ago