A pairs T
G pairs C
so the complementary strand will be
T A G G C C T A A G T A G C
What is the complementary strand of the following DNA strand? Drag each label to the appropriate...
Replicate the DNA strand below and create a complementary strand. Remember that complementary bases will always match with each other Adenine--Thymine and Cytosine--Guanine. AGCCCGTCTTGGAAT
For the following DNA strand: ATTTTAAGCTAAGCTCCA (a) Write the complementary strand, (b) Calculate the number of hydrogen bonds existing between the strands, (c) Specify the 5’ and 3’ ends for each strand.
Give the sequence of the complementary strand of the following DNA of one DNA strand of a DNA double helix is the (6 pts) nd of the following DNA strands. The nucleotide sequence a. 5'-GGATTTTTGTCCACAATCA-3' b. 3'-TTCGAGTCCAAGTCGTACTA-S or magnesium chloride (MgCl) is dissolved in 2.40 L of water. (Molar mass of MgCl2 -.11g/mole) (15 pts) a. What is the molarity of solution? b. How many moles of MgCl, are contained in 1.76L of solvent? C. How many liters of solvent...
2 [Type text] 3. Using this strand of DNA: AATACCGATACGGGGCAACTAAA a. Create the complementary DNA strand (1 pts.) b. Create the complementary mRNA strand (from the original strand) (2 pts) c. Create the protein (refer to Table 1 on page 3 as needed) (2 pts.)
If the sequence of the 5'-3'DNA strand is AATGCTAC, then the complementary DNA sequence has the following sequence o 3-AATGCTAC-5' 3'-CATCGTAA-5 3-GTAGCATT-5 3-TTACGATG-5 Question 2 20 pts Which of the following does the enzyme primase make? phosphodiester linkages (bonds) Okazaki fragments RNA primer DNA primer In which direction does DNA replication take place? 3'to 5 5'to 5 5'to 3 3'to 3 Question 4 20 pts Which enzyme unwinds the double-stranded helical DNA starting at the origin of replication? ligase primase...
Transcribe each of the following DNA sequences. Label the TEMPLATE DNA strand The arrow shows the direction of transcription. Draw the corresponding RNA molecule and label the 5' and 3' ends
9. a. In the box A below, fill in the complementary strand of DNA to create a double strand. b. Next to the box, using two different colored pens/pencil, create two new strands from the original strand in the box A. Label which color represents the original strand and which color represents the new strand. Part b: Box A: | ΑΙΤΙ TA G C G ТА Ат Ат G C O
1. What is the nucleotide sequence of the DNA strand that is complementary to 5-ATCGCAACTGTCACTA-3'?
New DNA Reverse transcriptase moves to the other strand and completes complementary (minus) strand DNA synthesis Continued synthesis of DNA leads to extension of the minus-strand DNA. Primer New DNA Reverse transcription of -100 nucleotides at the 5' terminus is catalyzed by reverse transcriptase Completion of a short segment of the plus strand DNA and removal of both primers Ribonuclease activity removes all the plus strand of RNA except for a small fragment used as a primer. Transfer of DNA...
What is the complementary sequence to the DNA strand 5' TGACGTGAT 3'? Enter the sequence in the 3' to 5' direction.