Homework Answers
Eukaryotes have specific sequence like conserved sequence "TATA" box where RNA polymerase binds and start the transcription. RNA polymerase recognized the specific specific sequence in eukaryotes that are different from prokaryotes. There are many in silico methods are available that recognize these specific sequence in the gene sequence and help in the identification of promoter sequence.
As, many organism, genome sequence are completely annotated now, there promoter sequences have been identified and computer program have been trained on these annotated promoter sequences of eukaryotes. For example , hidden Markov model, neural network, several algorithms have been designed that are able to recognize specific conserved sequences that are known as promoter.
Add Answer to:
Describe how you would study/characterize an unknown eukaryotic gene promoter (what methods you would use, what...
-Which elements are found in a eukaryotic promoter vs. a prokaryotic promoter? -what is the concept...
-Which elements are found in a eukaryotic promoter vs. a prokaryotic promoter? -what is the concept of (restriction enzyme produced) DNA fragment separation by gel electrophoresis -what are the steps and process of thermal cycling? -what is the restriction enzyme(s) and how do you know when they leave blunt or sticky ends (ie. XbaI, SmaI, EcoRI, BamHI)? -The lac and trp operons (form a figure showing the operon). - What is RNA silencing involvee (in general, what is RNA interference;...
4. The non-template strand sequence of a eukaryotic gene is given below. The promoter sequence is...
4. The non-template strand sequence of a eukaryotic gene is given below. The promoter sequence is underlined. The +1 nucleotide is shown in boldface and red. a. Write the sequence of the mRNA that would be produced by this gene. You may assume that the gene ends at the end of the sequence shown, so you do not need to look for transcription termination signals. You may also assume that it has no introns 5' GCGGTATAACAGGACAGGCTGCATGAGAAGATTCCATCTTCCAGATCACTGTCCTTCTAGCCATGGAAAATGA CGAATTGTGACTGCCCCTGC3' mRNA (make sure...
Outline the steps required to close a eukaryotic gene using E. coli from mRNA derived from...
Outline the steps required to close a eukaryotic gene using E. coli from mRNA derived from cells expressing the gene. Include how you would amplify the specific gene and how you would select for bacterial cells containing the cloned gene if the gene was inserted into a multiple cloning site within the lacZ gene on a plasmic. If you wanted to later express the gene using a eukaryotic expression vector and promoter how would you ensure the gene was in...
Briefly describe how you would conduct a mixed methods study that focuses on the association between...
Briefly describe how you would conduct a mixed methods study that focuses on the association between Mental Distress and HIV infection in an adult population. Address what type of mixed methods study and the level of Mixing.
Can someone please help me answer these questions. Thank you! Eukaryotic transcription signals a) This drawing shows the placements of the four main sequences of the eukaryotic core promoter for RNA...
Can someone please help me answer these questions. Thank
you!
Eukaryotic transcription signals
a) This drawing shows the placements of the four main sequences of
the eukaryotic core promoter for RNA polymerase II. Identify each
one and give a brief explanation
b) Which sequences are used in a DPE-driven promoter?
c) Which ones are used in a TATA-driven promoter?
d) Please draw and describe the steps as the transcription factors
work with eukaryotic RNA polymerase II to start transcription of...
Explain how you would approach the examination of the abdomen and what methods you might use...
Explain how you would approach the examination of the abdomen and what methods you might use to elicit patient cooperation. Describe how you would approach a child versus an adult and what you might say to help with your exam.
How would you characterize Pepsico’s diversification strategy? Is it Related? Unrelated? Mixed? Describe one strength that...
How would you characterize Pepsico’s diversification strategy? Is it Related? Unrelated? Mixed? Describe one strength that supports Pepsico’s diversification strategy. What is keeping Pepsico from continuing to grow?
The diagram below shows a structure of an eukaryotic gene. Each pattern refers to a different...
The diagram below shows a structure of an eukaryotic gene. Each pattern refers to a different part of a gene. Using the pattern, label the diagram for the location of following: a. enhancer, b- promoter, c- transcription start, d- translation start: e- exon, i- intron, f- coading sequence, t1 -transcription stop, t2 -translation stop Put the corresponding letter on top of the pattern to show the location b. How pre-mRNA transcribed from this gene will look like? You may use...
Describe at least three recruitment and selection methods and indicate how you would use each as...
Describe at least three recruitment and selection methods and indicate how you would use each as a manager.
1. What are GMO's, how are they created? Describe the methods used to create and identify...
1. What are GMO's, how are they created? Describe the methods used to create and identify the GMO's (promoter, terminator, PCR, etc.). What is artificial selection? Describe how farmers use artificial selection to improve crops?3. The results of your experiment and a figure inserted with the
4. The non-template strand sequence of a eukaryotic gene is given below. The promoter sequence is underlined. The +1 nucleotide is shown in boldface and red. a. Write the sequence of the mRNA that would be produced by this gene. You may assume that the gene ends at the end of the sequence shown, so you do not need to look for transcription termination signals. You may also assume that it has no introns 5' GCGGTATAACAGGACAGGCTGCATGAGAAGATTCCATCTTCCAGATCACTGTCCTTCTAGCCATGGAAAATGA CGAATTGTGACTGCCCCTGC3' mRNA (make sure...
Can someone please help me answer these questions. Thank
you!
Eukaryotic transcription signals
a) This drawing shows the placements of the four main sequences of
the eukaryotic core promoter for RNA polymerase II. Identify each
one and give a brief explanation
b) Which sequences are used in a DPE-driven promoter?
c) Which ones are used in a TATA-driven promoter?
d) Please draw and describe the steps as the transcription factors
work with eukaryotic RNA polymerase II to start transcription of...
Explain how you would approach the examination of the abdomen and what methods you might use to elicit patient cooperation. Describe how you would approach a child versus an adult and what you might say to help with your exam.
The diagram below shows a structure of an eukaryotic gene. Each pattern refers to a different part of a gene. Using the pattern, label the diagram for the location of following: a. enhancer, b- promoter, c- transcription start, d- translation start: e- exon, i- intron, f- coading sequence, t1 -transcription stop, t2 -translation stop Put the corresponding letter on top of the pattern to show the location b. How pre-mRNA transcribed from this gene will look like? You may use...
1. What are GMO's, how are they created? Describe the methods used to create and identify the GMO's (promoter, terminator, PCR, etc.). What is artificial selection? Describe how farmers use artificial selection to improve crops?3. The results of your experiment and a figure inserted with the
Most questions answered within 3 hours.
-
If a block of Si is doped with 10^17 Boron atom/cm^3 and 5X10^16
Arsenic atoms/cm^3,
(a)...
asked 14 minutes ago -
Why would natural selection not minimize costs (in the form of
symptoms) of evolved defenses? (choose...
asked 31 minutes ago -
What is true about a critical task?
Latest finish time - latest start time = 0...
asked 34 minutes ago -
A company uses a
process costing system. Its Assembly Department's beginning
inventory consisted of 56,800 units,...
asked 34 minutes ago -
a
sealed glass cylinder contains 325 g of N2 gas at 1.02 atm at 20 c....
asked 38 minutes ago -
The main difference between an equity and a nonequity alliance
is that
A
equity alliances are...
asked 36 minutes ago -
Need help with this, in JAVA, using netbeans. A
complete response will receive a positive comment...
asked 45 minutes ago -
An imprest petty cash fund of $600 was established for minor
disbursements. At the end of...
asked 50 minutes ago -
Sharpe Cutter is a small company that produces specialty knives
for paper cutting machinery. The annual...
asked 54 minutes ago -
Calculating the Ka of a weak acid from
pH:
The pH of a 0.68M solution of...
asked 55 minutes ago -
1.What process is pushing back against gravity in the very
center (the core) of sun-like stars?...
asked 1 hour ago -
This question is from the textbook "Python for ArcGIS" by Laura
Tateosian:
Write a script "triangles.py"...
asked 1 hour ago