Can someone tell me why letter "C" might be correct. I think that it is letter "A" according to my prior knowledge. Please elaborate on the correct answer whether it is A or C. Thank you.
The correct answer for this question is option a only. This is so because the mRNA mokecmol code by wild type DNA molecule will be UGA which is a stop codon. And after mutation the mutant DNA will result in coding for Arginine amino acid instead of stoping the translation process by coding for stop codon.
Can someone tell me why letter "C" might be correct. I think that it is letter...
A template strand of DNA in a gene reads 3’ CCA AGC TCT 5’.
Using the codon chart provided, answer the following
questions:
-What is the sequence of amino acids that is produced when this
gene is translated?
-If a mutation causes a substitution (an A instead of a T) 3’
CCA AGC ACT 5’, what effect will it have on the mRNA transcript AND
on the protein?
-What do we call this type of mutation?
Second letter U С...
Question 10 (15 points) Given the following sequence for a template strand of DNA 3 - ATACTTTGTCGAGACCCGCTTCTTGCAGACTGGG A. Provide the mRNA sequence following transcription (include polarity) B. Provide the amino acid sequence using either the one letter or three letter abbreviations. Include polarity (N-or C-terminus) and be careful to start in the correct place: C. What if the "C" underlined above was changed to a T. What is the new codon? How does that affect the amino acid sequence? What...
genetic biology
5'-GCATGAGTCTGGTACGCTTTTAAAGC-3' 3-CATGCG-5' IIIII 3. (a) in the sequence above, what enzyme would you need to extend the short stretch of nucleotides shown on the bottom strand? (b) Write the sequence of the newly synthesized fragment and label its S' and 3' end. (c) The covalent bond between these adjacent nucleotides is what type of chemical bond? After using a chemical mutagen to generate mutations in a DNA sequence, scientists noted a mutation from C to T at the...
Please note that Questions 15 to 17 are connected
questions.
Question 15:
The following shows a partial DNA sequence from the wild-type
(normal) allele for the human leukemia-linked apoptotic
gene.
5' ATGCGATTAATCGGTAAA 3' (non-template strand)
3' TACGCTAATTAGCCATTT 5' (template strand)
Please answer the following questions:
(a) If the bottom strand serves as the DNA template for
transcription, what is the resulting mRNA sequence?
The mRNA sequence is 5' 3'. (2
marks)
5' AUG CGA UUA AUC GGU AAA 3' ?
Please enter...
i think it might be Glutamate, but im not sure.
Someone please help!! its the last question i need to
finish this mindtap.
please respond quickly too, its due TODAY at 11:59pm
EST
CENGAGE MINDTAP a se Chapter 9 Digging Deeper Conceptual Learning Activity Second base U C A G UUU Phenylalanine UCU UUC Phenylalanine UCC Leucine UCA Leucine UCG Leucine CCU Leucine CCC Leucine CCA Leucine CCG Isoleucine ACU Isoleucine ACC Isoleucine ACA Methionine ACG Cysteine U Cysteine C...
Can someone explain why C is correct and how to tell if they
exhibit optical isomerism or not.
Which of the following can exhibit optical isomerism?
Some amino acids are post-translationally removed from the
C-terminal end of the beta-lactamase enzyme from B.
imaginarium (i.e. - after it is translated and
released from the ribosome, a protease chews off a some amino
acids). The wild-type enzyme, which has had the amino
acids removed from the C’-terminus, is 246 amino acids in length
and the C-terminal amino acids are shown below aligned with the
C-terminal amino acids of a frameshift mutant, which – due to a
frameshift mutation -...
i feel like 3 of these are saying the same thing, can
someone tell me?
QUESTION 3 Introns: a) can be randomly spliced out to allow translation to produce the correct polypeptide, b) must be precisely spliced out to allow translation to produce the correct polypeptide. c) are spliced out of the DNA d) indicate where the poly A tall should be placed. e) are structural for mRNA.
I don't know how to distinguish between the coding/noncoding
strand on the problem. I have to put fragment into cut segment and
then determine what happened when that occurred and why the
experimenter is receiving the observations she's getting.
Please do ligation, transcription and translation.
(IV). A cloning vector is cut with the restriction endonuclease
Sma 1, whose restriction site is
C C C (cut in between here, as shown in image) G G G
and treated with alkaline phosphatase...
Follow the instructions below to answer questions about
Replication, Transcription & Translation.
3’- T A C A
C C G G
T C A G
G T G A T C
-5’
A. Imagine that the sequence shown represents one strand of a
gene sequence. What would be the sequence of the complementary
strand of DNA? Write out your answer, indicating correct
polarity (5' and 3' ends) on your new strand. (1.5
points)
B. Now imagine that the new strand...