While working at the bench, you forgot to label two tubes of DNA strands. You know...
While working at the bench, you forgot to label two tubes of DNA strands. You know the sequences of each DNA strand and that they contain different amounts of G:C base pairs, but you do not know which strand is in which tube. Describe how you can use spectrophotometry to properly label your two tubes.
i am in a junior molecular biology class.
Homework Answers
By analysing melting curve of DNA using UV spectrophotometry , two tubes of DNA strands can be labeled properly. The DNA strand having more GC rich wil have high melting temperature ,so melting curve will rise while another strand having less GC content will have low melting temperature .
Add Answer to:
While working at the bench, you forgot to label two tubes of DNA
strands. You know...
Which of the following is true? a. The two strands of a DNA molecule are held...
Which of the following is true? a. The two strands of a DNA molecule are held together by covalent bonds. b. Hydrogen bonding between complementary base pairs causes the DNA molecule to twist into a spiral. c. A single strand within a DNA molecule is held together by hydrogen bonds. d. The bases on one strand of DNA are held to the bases on the other strand by hydrogen bonds.
In a test tube, a strand of double-stranded DNA can be separated into two single-stranded DNA...
In a test tube, a strand of double-stranded DNA can be separated into two single-stranded DNA molecules by applying energy such as heat. Sequences for two different dsDNA molecules are shown below (dsDNA 1 and dsDNA 2). Which one of these two would require less energy to be separated? Explain your reason. Note: Both dsDNA are 20 base pairs long. The sequence for only one of the strands in each dsDNA are shown dsDNA 1: GCGCACGGACGGCCCGCACC dsDNA 2: TATTAGTATACTAATAAGTT
Suppose you filled one test tube with alanine and a second test tube with casein, but forgot to label the test tubes. What test could you run on the samples to confirm which test tube contained the alanine? Explain.
Suppose you filled one test tube with alanine and a second test tube with casein, but forgot to label the test tubes. What test could you run on the samples to confirm which test tube contained the alanine? Explain.
If you wish to sequence a long strand of DNA in one round of reactions, you...
If you wish to sequence a long strand of DNA in one round of reactions, you should: O A. Decrease the ddNTP/dNTP ratio O B. Increase the ddNTP/dNTP ratio O C. Use a shorter DNA primer O D. Add twice as much primer Based on this figure, the most likely error is: O A. The scientist forgot to add dNTPs to one of the reaction tubes. O O B. <label for="q7_4" id="lq7_4">The scientist did not denature the DNA strands</label> O...
You are examining two tubes of nutrient broth that are not labeled with the names of...
You are examining two tubes of nutrient broth that are not labeled with the names of the bacteria they contain. One tube contains E.coli; the other tube contains S. marcescens. Based only on your observation of the two tubes, how would you know which tube contains S. marcescens?
a) Suppose you label dividing cells with ^32P. In which DNA molecules will the radioactivity be...
a) Suppose you label dividing cells with ^32P. In which DNA molecules will the radioactivity be incorporated if you were to look during metaphase? b) Suppose you are examining the above cells after replication. In which DNA molecules will the radioactivity be present? In one picture, draw a schematic indicating how DNA is synthesized bi-directionally. The schematic should indicate which are the lagging strands, which are the leading strands, where the RNA primers are, and the 3' and 5' orientation...
sample 1 is dna vir sample 2 rna vir am i in the right path you...
sample 1 is dna vir sample 2 rna vir am i in the right path
you
have to name the sample
Biology I student forgot to label three different sample tubes that contained human, single- corona virus, and single-stranded DNA Phi X 174 virus. The table shows the nucleotide ch sample, except for the nucleotide uracil, which is excluded. Identify each unknown sample correct sample name. Sample 1 Sample 2 Sample 3 ple name 17% 15% 33% 49% 31% 33%...
Does the Death Penalty Costle X Files x 9.2 DNA Replication - Concept x + om/courses/19926/files?preview=1637200...
Does the Death Penalty Costle X Files x 9.2 DNA Replication - Concept x + om/courses/19926/files?preview=1637200 cure Checkout Concepts of Biology Lifespan Developm. 111FAQ2020.docx 111 terms pdf 111welcome2020 pdf Page < 1 > of 3 - ame: Section DNA Replication Worksheet (10 Points) Instructions: Below is a representation of a DNA double helix about to be replicated. Using pencil, draw and label the following items according to the instructions for each. 1) Label the S' and 3' ends of both...
8) You have extracted DNA from two different organisms. In the purification process, you find that...
8) You have extracted DNA from two different organisms. In the purification process, you find that the two test tubes have lost their identifying labels. The sequences of DNA are: Sample 1: TCC CTA TGC CCG AGG GAT ACG GGC Sample 2: CGA TCT TAA CCC GCT AGA ATT GGG The only other piece of information you have is the corresponding amino acid sequence of a particular protein for both organisms. Organism I has ala-arg-ile-gly and organism II has ala-arg-ile-pro....
8) You have extracted DNA from two different organisms. In the purification process, you find that...
8) You have extracted DNA from two different organisms. In the purification process, you find that the two test tubes have lost their identifying labels. The sequences of DNA are: Sample 1: TCC CTA TGC CCG ///// AGG GAT ACG GGC Sample 2: CGA TCT TAA CCC ///// GCT AGA ATT GGG The only other piece of information you have is the corresponding amino acid sequence of a particular protein for both organisms. Organism I has ala-arg-ile-gly and organism II...
In a test tube, a strand of double-stranded DNA can be separated into two single-stranded DNA molecules by applying energy such as heat. Sequences for two different dsDNA molecules are shown below (dsDNA 1 and dsDNA 2). Which one of these two would require less energy to be separated? Explain your reason. Note: Both dsDNA are 20 base pairs long. The sequence for only one of the strands in each dsDNA are shown dsDNA 1: GCGCACGGACGGCCCGCACC dsDNA 2: TATTAGTATACTAATAAGTT
If you wish to sequence a long strand of DNA in one round of reactions, you should: O A. Decrease the ddNTP/dNTP ratio O B. Increase the ddNTP/dNTP ratio O C. Use a shorter DNA primer O D. Add twice as much primer Based on this figure, the most likely error is: O A. The scientist forgot to add dNTPs to one of the reaction tubes. O O B. <label for="q7_4" id="lq7_4">The scientist did not denature the DNA strands</label> O...
a) Suppose you label dividing cells with ^32P. In which DNA molecules will the radioactivity be incorporated if you were to look during metaphase? b) Suppose you are examining the above cells after replication. In which DNA molecules will the radioactivity be present? In one picture, draw a schematic indicating how DNA is synthesized bi-directionally. The schematic should indicate which are the lagging strands, which are the leading strands, where the RNA primers are, and the 3' and 5' orientation...
sample 1 is dna vir sample 2 rna vir am i in the right path
you
have to name the sample
Biology I student forgot to label three different sample tubes that contained human, single- corona virus, and single-stranded DNA Phi X 174 virus. The table shows the nucleotide ch sample, except for the nucleotide uracil, which is excluded. Identify each unknown sample correct sample name. Sample 1 Sample 2 Sample 3 ple name 17% 15% 33% 49% 31% 33%...
Does the Death Penalty Costle X Files x 9.2 DNA Replication - Concept x + om/courses/19926/files?preview=1637200 cure Checkout Concepts of Biology Lifespan Developm. 111FAQ2020.docx 111 terms pdf 111welcome2020 pdf Page < 1 > of 3 - ame: Section DNA Replication Worksheet (10 Points) Instructions: Below is a representation of a DNA double helix about to be replicated. Using pencil, draw and label the following items according to the instructions for each. 1) Label the S' and 3' ends of both...
Most questions answered within 3 hours.
-
Calculate the number density of argon gas at a temperature of
24C and a pressure of...
asked 1 hour ago -
Alternative
Classification
How to Estimate
Probabilities from Data? ( For continuous Attributes)
And How to generate...
asked 1 hour ago -
An explosion breaks a 20.0-kg object into three parts. The
object is initially moving at a...
asked 2 hours ago -
Calculate the approximate number of residues of Rubisco, which
is involved in carbon fixation in plants,...
asked 3 hours ago -
Other decisions about scientific claims can have a much broader
impact.ENERGYarrow-10x10.png, environment, health, security - all...
asked 4 hours ago -
I need to write a research paper and work cited about this
topic: The United States...
asked 4 hours ago -
Hello! I was wondering if I could have some help?
If the vapor pressure of carvone...
asked 4 hours ago -
An economist wants to estimate the mean per capita income (in
thousands of dollars) for a...
asked 5 hours ago -
What would be the input/output characteristic of a circuit
obtained by putting two of your 2's-complementers...
asked 5 hours ago -
In Drosophila, the transition from the syncytial blastoderm
stage to the cellular blastoderm stage is a...
asked 5 hours ago -
Project management question:
Name 3 different types of resources (hint: humans are one
type)
asked 5 hours ago -
Consider the following reaction: C 2H 2( g) + 2H 2( g) C 2H 6(
g)...
asked 6 hours ago