We need at least 10 more requests to produce the answer.
0 / 10 have requested this problem solution
The more requests, the faster the answer.
16026581&OpenVellumHMAC=597c55a548d14c5b5ec1bb8da28c7131010001 ce 16 of 16 Normal DNA (template strand) < A TG C т А с...
DNA is double stranded, but only one strand is used as a template for transcription. How does the cellular machinery determine which strand to use as the template? Choose the best answer. O It always starts on the 5' end. O The sequence of the DNA that will be transcribed determines which strand will be used. O It always starts on the 5' end closest to the centromere. O The location and orientation of the promoter determine which strand will...
Question 38 16 pts Question Code CDC The following sequence represents the DNA template strand of a gene, 3'-TAC CGT GTC TCC TCA GGC ATC-5' nucleotide number 1 21 a. What is the mRNA transcribed from this sequence? b. What is the amino acid sequence translated from the mRNA? c. If there is a transition at nucleotide #10, what is the amino acid sequence? R REROS d. What type of mutation is this (choose from frameshift, missense, nonsense, silent)? e....
A template strand of DNA in a gene reads 3’ CCA AGC TCT 5’. Using the codon chart provided, answer the following questions: -What is the sequence of amino acids that is produced when this gene is translated? -If a mutation causes a substitution (an A instead of a T) 3’ CCA AGC ACT 5’, what effect will it have on the mRNA transcript AND on the protein? -What do we call this type of mutation? Second letter U С...
Question 10 (15 points) Given the following sequence for a template strand of DNA 3 - ATACTTTGTCGAGACCCGCTTCTTGCAGACTGGG A. Provide the mRNA sequence following transcription (include polarity) B. Provide the amino acid sequence using either the one letter or three letter abbreviations. Include polarity (N-or C-terminus) and be careful to start in the correct place: C. What if the "C" underlined above was changed to a T. What is the new codon? How does that affect the amino acid sequence? What...
опре... А SENIOR COMPR... ♡ ♡ ♡ ♡ 14 / 16 63.8% SUCCES WITH PILLS e. Proteins are being digested to provide energy. 106. CELL BIOLOGY BIOL 3480 Which one of the following is incorrect about genetic code? a. It is fairly universal b. It is a triplet code. c. It is non-overlapping. d. It is degenerate. e. There is a single three-letter code per each amino acid. CELL BIOLOGY BIOL 3480 Which one of the following is incorrect about...
A mutation is a permanent change in the sequence of nucleotide bases in a cell's DNA. Most mutations happen during DNA replication, but their effects are not seen until transcription and translation. Even a small mutation that changes a single nucleotide can have a major impact on the resulting proteins that are made in the cell. с The table following the amino acid chart lists a segment of a normal gene. Type in the corresponding mRNA strand and the amino...
multiple choice question Consider the DNA coding (non-template) strand: 5-AAG TAC-3 What would be the amino acid sequence (using the three-letter abbreviations) for the resulting dipeptide? Becond GU الا لا 16 First Base BE LE ACC Third Base > COCO لا لا لا | GCA GCG GAG- GGG - Lys-Tyr Phệ-Met His-Glu Lys-Tyr 8 Phe-Met His-Glu Met-His + Change seat Send a message to the instructor < Join another session
Assume that the The DNA changes provided above represent the sequences in the TEMPLATE STRAND. Determine what effect would mutation 3 have on the protein. For location of mutation- either "Present in mature RNA"or "Absent in mature RNA" For Amino Acids- three letters in upper case, if no amino acids are formed, write "NA", if stop codon is coded write "STOP" For type of change-write "missense", "nonsense", "silent", "neutral" or "NA" Location of mutation Amino acid for Amino acid Type...
11 Department of Biological Sciences BIOCHEMISTRY Test 2.2018 H. Nucleic Acid, Sequencing of DNA: Amino Acids Hydrolysis of salt Laboratory buffers, Polyprotie acids QUESTIONS 1. The DNA strand complementary to the strand 3-GTAGCGTAT-Y' would have the sequence a SLTACOCATAT-3 b.3.CATOXICATA-S c. 3-ATGCGTATA-S" ATATGCGTAS 2. When cytosine is treated with bisulfite, the amino group is replaced with a carbonyl group. Identify the resulting base a. adenine b. guanine c uracil d. thyminee. typoxanthine 3. How many amino acids would be in...
21-1114 Date Transcription Kit Checklist Part 1: Making mRNA 1. Parts of a nucleotide: Approved Sugar Phosphate Bases: Adenine Guanine Cytosine Uracil 2. One nucleotide Note: Omit 3-6 if not using the DNA Structure and Function Kit. 3. Separated DNA 4. Template DNA with one complementary nucleotide of RNA hydrogen bonded 5. Template DNA with strand of mRNA hydrogen bonded 6. Separated mRNA and duplex DNA molecule 7. Completed mRNA with cap and tail 8. The cap 9. The tail...