Question
allll pleas
Question 14 (1 point) Eukaryotes modify a primary RNA transcript to generate a final mRNA product. Which of the following mod
Question 18 (1 point) Origins, the site where DNA replication begins, frequently have a sequence that is high in A/T content.
Question 20 (1 point) Phosphate groups can be added to or removed from histones. Phosphates have an overall negative charge.
Question 25 (1 point) Which series of molecular transitions best represents the processes of: 1. replication 2. transcription
Question 33 (1 point) Sometimes bacteriophage (like lambda phage) integrate their DNA through site specific recombination. Th
Question 34 (1 point) Enhancers work to: OA) increase the level of transcription from a particular promoter B) degrade mRNA t
Question 37 (1 point) ✓ Saved The following results were achieved after performing an Ames test by exposing his- bacteria to
chemical 3 13 chemical 4 15 154 321 Which compound might be biotransformed by the liver to a more mutagenic compound? OA) che
0 0
Add a comment Improve this question Transcribed image text
Answer #1

Question 14-

ANSWER - (c) adding a poly (A) tail to the transcript by poly (A) polymerase.

EXPLANATION--

  • Transcription is occurs in the nucleus, where DNA is used to produce RNA molecule.
  • mRNA is used as template for synthesizing proteins in the cytoplasm of cell. Before the mRNA make it way out of nucleus, it must undergoes several modifications.
  • These modifications are three type -
  1. 5'- guanosine triphosphate capping
  2. Polyadenylation of 3' - end
  3. Spilicing

POLYADENYLATION OF 3'- END --

  • most eukaryotic mRNA have a chain of 40 t0 200 adenine nucleotide attached to 3'- end.
  • These are not transcribed  
  • In this modifications ,the 3'- end of pre mRNA are removed and a series of adenosine nucleotide is attached.
  • This process is called polyadenylation of 3'- end.
  • It provides stability and facilitate the exit of mRNA from nucleus.
  • The enzyme poly (A) polymerase help on these process.
  • After the mRNA enters the cytoplasm, the poly A tail is gradually shortened.

Other options

Option (A) - removing exons from the transcript.

Explanation- it is wrong statement. Introns are removed from transcript.

Option(B) - adding introns to the transcript.

Explanation- it is wrong statement. Exons are added . Introns are cut out from transcript.

Option (D) -adding start codon to the transcript after it's synthesis.

Explanation-it is also wrong.

Option (E) -removing a 5'- cap from transcript.

Explanation- it is incorrect. We add 5'- cap to transcript.

Add a comment
Know the answer?
Add Answer to:
allll pleas Question 14 (1 point) Eukaryotes modify a primary RNA transcript to generate a final...
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Not the answer you're looking for? Ask your own homework help question. Our experts will answer your question WITHIN MINUTES for Free.
Similar Homework Help Questions
  • Carvas X CO Inactivation of a specific transcription factor Modifications to the RNA transcript OPresence of...

    Carvas X CO Inactivation of a specific transcription factor Modifications to the RNA transcript OPresence of repressor protelns to reduce transcription Question 8 10pts The following lists many forms in which gene expression ls regulated in Eukaryotes. Which of those is common to both prokaryotes and eukaryotes? Tight colling of the DNA around histone proteins, making it inaccessible to RNA polymerase Protecting the mRNA by adding a 5 G-cap and 3 poly A tal O Repulating the availablity of transcription...

  • Question 8 (1 point) The primary RNA transcript of the chicken ovalbumin gene is 7700 nucleotides...

    Question 8 (1 point) The primary RNA transcript of the chicken ovalbumin gene is 7700 nucleotides long, but the mature mRNA that is translated on the ribosome is 1872 nucleotides long. This size difference occurs primarily as a result of: O addition of the poly A tail O removal of exons O splicing O addition of the 5' cap Question 7 (1 point) Which of the following recognizes the promoter region of a gene in E. coli allowing RNA polymerase...

  • all of them please Question 17 (1 point) If there is lots of tryptophan available, the...

    all of them please Question 17 (1 point) If there is lots of tryptophan available, the transcriptional output from the trp operon would be : A) basal B) very low C) very high Question 19 (1 point) Phosphate groups can be added to or removed from histones. Phosphates have an overall negative charge. You would expect the addition of phosphate groups to histone proteins would: A) tighten DNA binding to the histone due to charge repulsion B) cause the DNA...

  • 1. Use the provided DNA template to synthesize a complementary strand. (1 point)5’ ATGCGTATACGTTCCGTCGCCTAA 3’ 2....

    1. Use the provided DNA template to synthesize a complementary strand. (1 point)5’ ATGCGTATACGTTCCGTCGCCTAA 3’ 2. What enzyme facilitates the complementary base pairing used to make the complementary strand in question #1. 3. At what site on the DNA molecule does transcription initiate? At what site on the DNA does transcription terminate? 4. Use the DNA molecule from question #1 and transcribe an mRNA molecule. Show the nucleotide sequence of the mRNA molecule. 5. What enzyme is responsible for transcription?...

  • 1 pts DI Question 6 What region of this molecule shown would bind to mRNA during...

    1 pts DI Question 6 What region of this molecule shown would bind to mRNA during translation? 3' A-OH 5' A Cacceptor stem G C G- U TuC loop D-loop C U GACAC m'A GGAGAGm m' G C-G A-U variable loop Anticodon loop Cm U A Gm A A The 5' end The anticodon loop The 3 end The variable loop The acceptor stem D Question 7 1 pts What is synthesized during transcription? O a strand of tRNA O...

  • Answer the questions: Question 1 Transcription begins at the..... a. operon o b. repressor c. genome...

    Answer the questions: Question 1 Transcription begins at the..... a. operon o b. repressor c. genome 17d. promoter Question 2 0.5 points Save RNA is synthesized on a DNA template in a process called replication, DNA polymerase translation, RNA polymerase transcription, RNA polymerise t ranscription, DNA polymerase Question 3 Which eukaryotic RNA polymerase makes tRNA's? a RNA polymerase IIIb. Any of these RNA polymerase I od RNA polymerase II A Moving to another question will save this response. Question 4...

  • If the DNA template strand sequence at a particular region of a gene is 3-GGA-5. What...

    If the DNA template strand sequence at a particular region of a gene is 3-GGA-5. What amino acid would this result in after transcription and translation? Pro (Proline) Ser (Serine) Val (Valine) Arg (Arginine) Question 20 1 pts What is created during transcription? a strand of codons O a strand of tRNA a strand of anticodons a polypeptide • a strand of DNA IPS Which letter (representing a phase of the cell cycle) would you observe (S phase) synthesis and...

  • QUESTION 1 RNA poll initiates synthesis of the mRNA transcript without a primer True O False...

    QUESTION 1 RNA poll initiates synthesis of the mRNA transcript without a primer True O False QUESTION 2 En The +1 position identifies the location for translation to begin when bound the mRNA is bound by the ribosomal subunit. True False QUESTION 3 The small ribosomal subunit binds the mRNA transcript at a sequence that is complementary to the gene promoter in order to initiate translation. O True False QUESTION 4 The 5' cap is necessary for protection from exonuclease...

  • all them please Question 23 (1 point) The A and B alleles in ABO blood types...

    all them please Question 23 (1 point) The A and B alleles in ABO blood types can give rise to an individual that is blog type AB. This specific blood type is an example of: A) multiple alleles B) epistasis C) codominance D) partial dominance Imagine the gene encoding the lac repressor was mutated so that lactose (more technically allolactose) no longer bound to the repressor. However, the lac repressor was still capable of binding DNA at the operator sequence....

  • 1. A is a unit of nucleic Select the appropriate term from the table below to...

    1. A is a unit of nucleic Select the appropriate term from the table below to complete eacALUlllllell. tRNA rRNA replication transcription translation DNA. deletion translocation frame shift nucleus a l. A Duckohde unit of nucleic acid containing a sugar attached to is a phosphate group and a base. 2. The site of transcription is the the ribosome moves along the mRNA. 3. In the process of 4. A class of RNA molecules which is linked directly with protein synthesis,...

ADVERTISEMENT
Free Homework Help App
Download From Google Play
Scan Your Homework
to Get Instant Free Answers
Need Online Homework Help?
Ask a Question
Get Answers For Free
Most questions answered within 3 hours.
ADVERTISEMENT
ADVERTISEMENT
ADVERTISEMENT