Interrupted coding sequences include long sequences of bases that do NOT code for amino acids. These...
- Interrupted coding sequences include long sequences of bases
that
do NOT code for amino acids. These noncoding sequences, called ________, are found in ________ cells.
- exons; prokaryotic
- introns; prokaryotic
- exons; eukaryotic
- introns; eukaryotic
- none of these are correct
Homework Answers
Interrupted coding sequences include long sequences of bases that do NOT code for amino acids. These noncoding sequences, called introns, are found in eukaryotic cells.
In this case, introns are part of the basic structure of the eukaryotic gene. Once the gene is transcribed into mRNA, the introns will be removed through a process called splicing.
Add Answer to:
Interrupted coding sequences include long sequences of bases
that
do NOT code for amino acids. These...
QUESTION 29 How long would a mRNA coding for a protein with 106 amino acids be...
QUESTION 29 How long would a mRNA coding for a protein with 106 amino acids be if it had 5' and 3' UTRs of 30 bases each? (Assume stop codon is part of the last exon)
How many different mRNA sequences can code for a polypeptide chain with the amino acid sequence...
How many different mRNA sequences can code for a polypeptide chain with the amino acid sequence Met - Leu - Arg? Be sure to include a stop codon. Explain your answer! 5′ ...GGAGCUCGUUGUAUU... 3′ Is this sequence RNA or DNA? How can you tell? Which amino acids are encoded, if the reading frame is as shown, starting from the correct end? What would be the effect on the amino acid sequence if the sequence were changed to 5′ GGAGACUCGUUGUAUU 3′?...
11. A gene is best defined as a. A segment of DNA b. Three nucleotides that...
11. A gene is best defined as a. A segment of DNA b. Three nucleotides that code for an amino acid. C. A sequence of nucleotides in DNA that codes for a functional product. d. A sequence of nucleotides in RNA that codes for a functional product. e. A transcribed unit of DNA. 12. Which of the following statements is false? a. DNA polymerase joins nucleotides in one direction only. b. The leading strand of DNA is made continuously c....
Which of the following statements is true? A. RNA polymerase has a proofreading activity B. Prokaryotic...
Which of the following statements is true? A. RNA polymerase has a proofreading activity B. Prokaryotic RNA usually undergoes nuclear processing C. Polypeptides are synthesized by addition of amino acids to the amino terminus. D. The 3' end of mRNA corresponds to the carboxyl terminus of the protein. Grade 2. Which of the following A. It may be autocatalytic. B. Spliceosomes are present in organelles and nuclei C. It involves removal of exons is true regarding RNA processing? D. It...
In prokaryotes the consensus sequence begins. is located about 10 bases upstream from the initiation site....
In prokaryotes the consensus sequence begins. is located about 10 bases upstream from the initiation site. It has the and is responsible for identifying the precise nucleotide at which TATA box, TATAAA, transcription Pribnow box, TATAAT, transcription 0 0 0 0 0 Pribnow box, TATAAT, translation Pribnow bow, TTGACA, translation None of the answers are correct Ribosomes are made of: 1. rRNA 2. proteins 3. URNA 3 2 Both 1 and 2 are correct All answers are correct 1 Once...
where does transcription begin 3. List the major types of RNA and include what they code...
where does transcription begin
3. List the major types of RNA and include what they code for, their function in the cell and which type is translated. 4. If a bacterial protein has 2,500 amino acids long, how many nucleotide pairs long is the ger sequence that codes for it? 5. Where does transcription begin? 6. What is the template and nontemplate strands of DNA? 7. Why is only one strand transcribed, and is the same strand of DNA always...
O ACTIVITY 5.4.1 Synthesis of a Protein: A Simulation Activity In this activity, you will be...
O ACTIVITY 5.4.1 Synthesis of a Protein: A Simulation Activity In this activity, you will be provided with the DNA nucleotide sequence that codes for a hypothetical protein. The code will be provided to you in three fragments. You will have to tran- scribe the code into mRNA, remove an intron segment, and translate the mRNA into the protein. In addition, you will have to identify the beginning fragment the middle fragment, and the end fragment. Sequence A TCTTCCCTCCTAAACGTTCAACCGGTTCTTAATCCGC CGCCAGGGCCCCGCCCCTCAGAAGTTGGT...
G alpha z (Gaz) is a protein of 355 amino acids in length. It is synthesized...
G alpha z (Gaz) is a protein of 355 amino acids in length. It is synthesized in the cytoplasm and has no signal sequence, nor a start-transfer sequence, nor a nuclear import sequence or patch. After its initial synthesis, Gaz is bound by another protein called a palmitoyltransferase, which covalently attaches a fatty acid called palmitate to a cysteine side chain near the N-terminus of Gaz. This lipid modification allows Gaz to associate with the inner face of the plasma...
onaformation from a ee is used in the synthesisof 17 functional gene product. A) Geno B)...
onaformation from a ee is used in the synthesisof 17 functional gene product. A) Geno B) Gene regulation C) Epigenetics D) Imprinting E) Chromatin remodeling 18. A histone code is the: A) B) nucleotide sequence of an individual histone protein's gene. pattern of chemical modification of the DNA wrapped around an individual histone. C) D) E) pattern of chemical modification of the histone tails. number of amino acids in an individual histone that are methylated None of the other answer...
QUESTION 6 Assume you are studying a protein-coding gene, ACEX, which includes 4 exons as illustrated...
QUESTION 6 Assume you are studying a protein-coding gene, ACEX, which includes 4 exons as illustrated in the gene map below. The 5' UTR and 3' UTR segments are each 25 bp long. Exons 1 thru 4 are 100, 200, 300, 400 bp long, respectively. Each intron is 200 bp each. The locations of the relevant EcoRI sites within the ACEX locus are indicated, but the location of other restriction enzyme sites (like BamHI) are not shown." EcoRI probe EcoRI...
QUESTION 29 How long would a mRNA coding for a protein with 106 amino acids be if it had 5' and 3' UTRs of 30 bases each? (Assume stop codon is part of the last exon)
11. A gene is best defined as a. A segment of DNA b. Three nucleotides that code for an amino acid. C. A sequence of nucleotides in DNA that codes for a functional product. d. A sequence of nucleotides in RNA that codes for a functional product. e. A transcribed unit of DNA. 12. Which of the following statements is false? a. DNA polymerase joins nucleotides in one direction only. b. The leading strand of DNA is made continuously c....
Which of the following statements is true? A. RNA polymerase has a proofreading activity B. Prokaryotic RNA usually undergoes nuclear processing C. Polypeptides are synthesized by addition of amino acids to the amino terminus. D. The 3' end of mRNA corresponds to the carboxyl terminus of the protein. Grade 2. Which of the following A. It may be autocatalytic. B. Spliceosomes are present in organelles and nuclei C. It involves removal of exons is true regarding RNA processing? D. It...
In prokaryotes the consensus sequence begins. is located about 10 bases upstream from the initiation site. It has the and is responsible for identifying the precise nucleotide at which TATA box, TATAAA, transcription Pribnow box, TATAAT, transcription 0 0 0 0 0 Pribnow box, TATAAT, translation Pribnow bow, TTGACA, translation None of the answers are correct Ribosomes are made of: 1. rRNA 2. proteins 3. URNA 3 2 Both 1 and 2 are correct All answers are correct 1 Once...
where does transcription begin
3. List the major types of RNA and include what they code for, their function in the cell and which type is translated. 4. If a bacterial protein has 2,500 amino acids long, how many nucleotide pairs long is the ger sequence that codes for it? 5. Where does transcription begin? 6. What is the template and nontemplate strands of DNA? 7. Why is only one strand transcribed, and is the same strand of DNA always...
O ACTIVITY 5.4.1 Synthesis of a Protein: A Simulation Activity In this activity, you will be provided with the DNA nucleotide sequence that codes for a hypothetical protein. The code will be provided to you in three fragments. You will have to tran- scribe the code into mRNA, remove an intron segment, and translate the mRNA into the protein. In addition, you will have to identify the beginning fragment the middle fragment, and the end fragment. Sequence A TCTTCCCTCCTAAACGTTCAACCGGTTCTTAATCCGC CGCCAGGGCCCCGCCCCTCAGAAGTTGGT...
onaformation from a ee is used in the synthesisof 17 functional gene product. A) Geno B) Gene regulation C) Epigenetics D) Imprinting E) Chromatin remodeling 18. A histone code is the: A) B) nucleotide sequence of an individual histone protein's gene. pattern of chemical modification of the DNA wrapped around an individual histone. C) D) E) pattern of chemical modification of the histone tails. number of amino acids in an individual histone that are methylated None of the other answer...
QUESTION 6 Assume you are studying a protein-coding gene, ACEX, which includes 4 exons as illustrated in the gene map below. The 5' UTR and 3' UTR segments are each 25 bp long. Exons 1 thru 4 are 100, 200, 300, 400 bp long, respectively. Each intron is 200 bp each. The locations of the relevant EcoRI sites within the ACEX locus are indicated, but the location of other restriction enzyme sites (like BamHI) are not shown." EcoRI probe EcoRI...
Most questions answered within 3 hours.
-
companies either hire outside programmers to
write_____ software or use their own internal developers.
asked 15 seconds from now -
Which food law was passed in 1996 and changed how pesticide
residues on food were regulated...
asked 30 seconds ago -
Probabilities and Counting. Yahtzee is a game that involves six
fair dice. When rolling all six...
asked 1 minute ago -
What percent of revenue does net income represent for each
year?
Total Revenue
2017 = 60,319,000...
asked 23 minutes ago -
For Ti+2 (Z=22). Determine the correct ground state
& # of microstates. Use the correct tanabe...
asked 26 minutes ago -
Why did so many investment banks have to start buying CDO’s and
other mortgaged backed securities...
asked 41 minutes ago -
The mean cost of domestic airfares in the United States rose to
an all-time high of...
asked 52 minutes ago -
1.Magazine Luiza is a Brazilian retail chain for consumer
electronics. The company currently has 100 stores...
asked 51 minutes ago -
What is the molarity of ZnCl2 that forms when 25.0 g of zinc
completely reacts with...
asked 53 minutes ago -
For independent X and Y, we have probability density function
for them where pdf of X...
asked 1 hour ago -
The decomposition of SO2Cl2 is first order in SO2Cl2 and has a
rate constant of 1.42...
asked 59 minutes ago -
How do I convert from volume percent to mole percent in the
distillation lab? ethy acetate...
asked 1 hour ago