Homework Answers
Answer:
Translation of the given mRNA is as follows:
mRNA = UUUCUUAUUGUGCUAGGGGCA
Protein = Phe – Leu – Ile – Val – Leu – Gly - Ala
Add Answer to:
Given the following sequence of mRNA, compose the protein that is coded for. mRNA: UUUCUUAUUGUGCUAGGGGCA Compose...
What is the nucleotide order of the conplimentary mRNA? What sequence of amino acids is coded...
What is the nucleotide order of the conplimentary mRNA? What
sequence of amino acids is coded by the DNA?
Question 1. For the following questions, use the genetic code in table 18.1. A DNA strand consists of 3'-TCAATACCCGCG-5'. What is the nucleotide order of the complimentary mRNA? What sequence of amino acids is coded by the DNA?
a) Transcribe and translate this sequence of DNA (write the mRNA sequence and protein code) TACATGCCG...
a) Transcribe and translate this sequence of DNA (write the mRNA sequence and protein code) TACATGCCG TTTCAG GGG TTAGGC GCGAAATGCATC mRNA: Protein: b) What happens if I insert an "A" at the 9* nucleotide position in the original sequence given? What is the protein message now? modified DNA: mRNA: Protein: c) Which enzyme was used during transcription? What is the machinery/organelle responsible for building the protein? I
Given the following mRNA sequence, 5'–CGCAAGGCCUAU–3?', answer the questions below. A link to a table of...
Given the following mRNA sequence, 5'–CGCAAGGCCUAU–3?', answer the questions below. A link to a table of codons can
be found here.
Given the following mRNA sequence, 5'-CGCAAGGCCUAU-3', answer the questions below. A link to aa table of codons can be found here a) What amino acid sequence, using the three-letter designations for amino acids, is coded for by the mRNA? b) If a mutation converts AAG to CAG, what is the amino acid sequence? c) What will the amino acid...
Protein structure is ultimately determined by: The codon sequence, which is coded for in the ribosome...
Protein structure is ultimately determined by: The codon sequence, which is coded for in the ribosome The order of genes in the genome The conditions in which the protein is assembled, and nothing else The primary sequence, which is coded for in DNA
Transcribe the following DNA sequence into mRNA, and then translate it into protein. Be sure to...
Transcribe the following DNA sequence into mRNA, and then translate it into protein. Be sure to figure out where translation would start, and where it would stop. DNA GGCTATACCGGTTACCGATAATTGGCTATCTG RNA: Protein:
QUESTION 27 Assume the sequence below shows the 5' end of a mRNA isolated from bacteria....
QUESTION 27 Assume the sequence below shows the 5' end of a mRNA isolated from bacteria. Determine the partial amino acid sequence of the protein coded by this mRNA. Type your answer using one-letter amino acid sequence with no spaces in between and starting with the N terminus. 5'GCCAUCAUGCUAGGAGGUUCACCGGAUGGGGUCACAGACGGCG.......
You are given the following sequence of DNA which encodes for a short protein (this is...
You are given the following sequence of DNA which encodes for a short protein (this is the template strand). 3'ATAGAAGTACCTCGGGCATTTTGAGTTAGCCACTGATACAT 5' 1) Write the sequence of the coding strand. Make sure to label your ends to indicate directionality. 2) Write the sequence of the mRNA. Assume that the entire molecule will be transcribed. Make sure to label your ends to indicate directionality. 3) Write the primary structure sequence of the protein which this would make. Make sure to label your...
Part A A particular mRNA is 300 nucleotides long. If a mutation in the middle of...
Part A A particular mRNA is 300 nucleotides long. If a mutation in the middle of the sequence changed a codon from a AAA to a UAA then what would be a reasonable prediction 0 The protein coded by his mRNA would be longer O The protein coded by this mRNA would kilthe cell O The protein coded by this mRNA would be the same size O The protein coded by this mRNA would be shorter O The protein coded...
All of the following apply to the process of protein synthessis except : the mRNA sequence...
All of the following apply to the process of protein synthessis except : the mRNA sequence is the rame as that of the DNA template smand (2) amino acids are juined together by ribosome ③ requires the expendture te of process enersy unwind bedre synthesized . tre gene must MRNA can be
3. The mRNA base sequence below codes for part of a protein. Using the genetic code...
3. The mRNA base sequence below codes for part of a protein. Using the genetic code table in your text (p. 731 or the inside back cover), determine the amino acid sequence encoded by this piece of mRNA. (13 pts) mRNA: CAU GAA CU ACCUA GUGCU GUUGAA AU CAC CGCGCUCCU A protein:
What is the nucleotide order of the conplimentary mRNA? What
sequence of amino acids is coded by the DNA?
Question 1. For the following questions, use the genetic code in table 18.1. A DNA strand consists of 3'-TCAATACCCGCG-5'. What is the nucleotide order of the complimentary mRNA? What sequence of amino acids is coded by the DNA?
a) Transcribe and translate this sequence of DNA (write the mRNA sequence and protein code) TACATGCCG TTTCAG GGG TTAGGC GCGAAATGCATC mRNA: Protein: b) What happens if I insert an "A" at the 9* nucleotide position in the original sequence given? What is the protein message now? modified DNA: mRNA: Protein: c) Which enzyme was used during transcription? What is the machinery/organelle responsible for building the protein? I
Given the following mRNA sequence, 5'–CGCAAGGCCUAU–3?', answer the questions below. A link to a table of codons can
be found here.
Given the following mRNA sequence, 5'-CGCAAGGCCUAU-3', answer the questions below. A link to aa table of codons can be found here a) What amino acid sequence, using the three-letter designations for amino acids, is coded for by the mRNA? b) If a mutation converts AAG to CAG, what is the amino acid sequence? c) What will the amino acid...
QUESTION 27 Assume the sequence below shows the 5' end of a mRNA isolated from bacteria. Determine the partial amino acid sequence of the protein coded by this mRNA. Type your answer using one-letter amino acid sequence with no spaces in between and starting with the N terminus. 5'GCCAUCAUGCUAGGAGGUUCACCGGAUGGGGUCACAGACGGCG.......
You are given the following sequence of DNA which encodes for a short protein (this is the template strand). 3'ATAGAAGTACCTCGGGCATTTTGAGTTAGCCACTGATACAT 5' 1) Write the sequence of the coding strand. Make sure to label your ends to indicate directionality. 2) Write the sequence of the mRNA. Assume that the entire molecule will be transcribed. Make sure to label your ends to indicate directionality. 3) Write the primary structure sequence of the protein which this would make. Make sure to label your...
Part A A particular mRNA is 300 nucleotides long. If a mutation in the middle of the sequence changed a codon from a AAA to a UAA then what would be a reasonable prediction 0 The protein coded by his mRNA would be longer O The protein coded by this mRNA would kilthe cell O The protein coded by this mRNA would be the same size O The protein coded by this mRNA would be shorter O The protein coded...
All of the following apply to the process of protein synthessis except : the mRNA sequence is the rame as that of the DNA template smand (2) amino acids are juined together by ribosome ③ requires the expendture te of process enersy unwind bedre synthesized . tre gene must MRNA can be
3. The mRNA base sequence below codes for part of a protein. Using the genetic code table in your text (p. 731 or the inside back cover), determine the amino acid sequence encoded by this piece of mRNA. (13 pts) mRNA: CAU GAA CU ACCUA GUGCU GUUGAA AU CAC CGCGCUCCU A protein:
Most questions answered within 3 hours.
-
Chargaff's results yielded a molar ratio of 0.400 for A to G in
avian tubercle bacillus...
asked 51 minutes ago -
Which of the following binds ATP/ADP?
a. microfilaments
b. microtubules
c. intermediate filaments
d. microfilaments and...
asked 54 minutes ago -
Assume that the situation can be expressed as a linear cost
function. Find the cost function....
asked 2 hours ago -
(Sort ArrayList) Write the following method that sorts an
ArrayList: public static > void sort(ArrayList list)...
asked 3 hours ago -
2) A 9 volt battery is connected to a parallel plate capacitor
with an initial capacitance...
asked 2 hours ago -
Prince Equipment has to decide whether to obtain $1,000,000 of
financing by: (1) selling common stock...
asked 3 hours ago -
The terms electrical and electronic have similar but
different meanings which of the following statement is...
asked 3 hours ago -
You wish to test the claim that the mean GPA of night students
is than 2.5...
asked 4 hours ago -
A soft drink machine outputs a mean of 25 ounces per cup. The
machine's output is...
asked 5 hours ago -
Ross Co., Westerfield, Inc., and Jordan Company announced a new
agreement to market their respective products...
asked 4 hours ago -
What is the distance run by a runner 50m/hr and
60m/hr?
asked 5 hours ago -
Write a descendant selector rule that affects the <em>
element that is contained within the
<p>...
asked 6 hours ago