Question

Explain what is meant by a frameshift mutation.


Explain what is meant by a frameshift mutation. Explain what effect this can have on the resulting protein produced.


Place these steps in the proper order for the process of going from DNA to protein. 

  • translation 

  • RNA processing (addition of 'cup and poly A tail and splicing) 

  • transcription 

  • modification of protein (proper folding, etc.)

1 0
Add a comment Improve this question Transcribed image text
Answer #1

24. Frameshift Mutation: It is a type of genetic mutation. When insertion or deletion occur in the DNA sequence which shifts the way of reading of the sequence or the reading of sequence will be shifted. Frameshift Mutation occur when normal sequence of the codons is disturbed/disrupted by deletion or insertion of one or more nucleotides.

Effect of frameshift Mutation on the resulting protein produced: If one nucleotide is inserted or deleted from sequence, then all codons which are included will have disrupt reading frame. It will result in incorporation of many of the incorrect amino acids into protein. Thus, the frameshift mutation will result in the abnormal protein product which means protein with incorrect amino acid sequence that can either shorter or longer than normal protein. The protein produced will be non-functional.

25. The steps in order for the process going from DNA to protein.

1. Transcription

2. RNA processing (addition of 5' cap and poly A tail and splicing).

3. Translation

4. Modification of protein (proper folding etc.)

Explanation: It is the central dogma in molecular biology, where RNA is synthesized from DNA that is known is transcription, then the new RNA molecules get processed and protein synthesis occur which is known as translation. After this modification of the protein occur.

Add a comment
Know the answer?
Add Answer to:
Explain what is meant by a frameshift mutation.
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Not the answer you're looking for? Ask your own homework help question. Our experts will answer your question WITHIN MINUTES for Free.
Similar Homework Help Questions
  • List the steps involved in the transcription and translation of DNA into mRNA and tRNA in order? DNA replicated to RNA t...

    List the steps involved in the transcription and translation of DNA into mRNA and tRNA in order? DNA replicated to RNA tRNA translates mRNA and adds amino acids to the growing peptide chain making a protein mRNA leaves nucleus Introns are excised from hnRNA Addition of 5' cap and poly-A tail to mRNA

  • The genetic code is read in groups of three (3) nucleotides called codons. Some mutations are...

    The genetic code is read in groups of three (3) nucleotides called codons. Some mutations are silent because they have no effect on the phenotype. How is that possible? Since there was a mutation in one of the codons, that gene will not be expressed. o It is not possible, mutations are always expressed and always have an effect The mutation changed the codon but the new codon codes for the same amino acid The ribosome knows there was a...

  • 3. Prokaryotic and eukaryotic gene expression compared. Below is an incomplete table of prokaryotic and eukaryotic...

    3. Prokaryotic and eukaryotic gene expression compared. Below is an incomplete table of prokaryotic and eukaryotic gene expression in comparison. Fill in the blank using PPT slides, notes and the textbook. Prokaryotic gene expression Eukaryotic gene expression Overview Steps Transcription and translation Yes Transcription and translation coupled? Gene structure No introns Epigenetic modification (chromosome remodeling) transcription, translation, RNA processing, protein processing Transcription in the nucleus and translation in the cytoplasm Interrupted gene with exons and introns RNAPI, II, III Which...

  • hello, two of these circled answers are incorrect. 1 6. The promoter sequences are the positions...

    hello, two of these circled answers are incorrect. 1 6. The promoter sequences are the positions that: signal the initiation site of a gene (+1) B) bind the transcriptional factor that is associated with RNA polymerase e) attach the correct nucleotide triphosphate to the template DNA strand D) separate the two DNA strands CUA 7. A particular triplet of bases in the coding sequence of DNA is GAT. The anticodon on the tRNA that binds the mRNA codon is A...

  • Not sure where I am going wrong. Each type of pre-mRNA processing has one or more...

    Not sure where I am going wrong. Each type of pre-mRNA processing has one or more important functions. Match the function with the appropriate type of processing XAddition of 5' cap Addition of poly(A) tail RNA splicing enables movement of mRNA out of the nucleus increases mRNA stability through addition of many non-DNA-templated nucleotides facilitates binding of ribosome to beginning of mRNA involves cleavage of RNA downstream of AAUAAA consensus sequence removes non-coding regions from pre-mRNA increases mRNA stability through...

  • Below is the DNA sequence of a protein-encoding Eukaryotic gene: 5’TAAACGCGATGGACCGACCATACAGTATCGACGCTCCAGGATGGTAAAATAAATGCCT3’ Based on this information, predict...

    Below is the DNA sequence of a protein-encoding Eukaryotic gene: 5’TAAACGCGATGGACCGACCATACAGTATCGACGCTCCAGGATGGTAAAATAAATGCCT3’ Based on this information, predict the mature mRNA sequence and the corresponding peptide sequence of this gene after transcription, RNA processing, and translation. Try to recognize and label the sequence features on the primary transcript you learned from the class that are important for Eukaryotic mRNA Processing (e.g. intron sites, poly-A adding site). Please also briefly describe the key steps taking place during RNA processing. For each step of...

  • answer all the questions 18) A mutation occurs such that a spliceosome cannot remove one of...

    answer all the questions 18) A mutation occurs such that a spliceosome cannot remove one of the introns in a gene. What effect will this have on the gene? Translation will continue, but a nonfunctional protein will be made b) Translation will continue and will skip the intron sequence c) It will have no effect; the gene will be transcribed and translated into protein d) Transcription will terminate easily and the protein will not be made 19. During the process...

  • can you guys please give me the correct answers and explain why? 9. Which of the...

    can you guys please give me the correct answers and explain why? 9. Which of the following statements is INCORRECT? A. Most human cells contain high levels of telomerase. B. Telomeres protect the ends of eukaryotic chromosomes. C. Telomerase is ribonucleoprotein D. Each round of replication shortens eukaryotic chromosomes. E. Telomerase is an RNA-dependent DNA polymerase. 10. DNA in front of the replication fork is positively supercoiled (over-wound). What is the source of energy required for this over-winding? Pollll Core...

  • Match the event or term with the proper process from the drop-down menu. Process terms may...

    Match the event or term with the proper process from the drop-down menu. Process terms may be used once, more than once, or not at all. Group of answer choices are:   [ Choose 1 answer per term]            DNA replication            G1 phase            Post-translational processing            Transcription            G2 phase            Post-transcriptional processing            S phase            Translation            Mitosis   ...

  • choose the right answer : 1- what is degradation of ' unwanted' proteins in eukaryotic cells...

    choose the right answer : 1- what is degradation of ' unwanted' proteins in eukaryotic cells A- polyribosomes B- proteasomes C- editosome D- spliceosomes 2- addition or deletion of bases causes which kind of mutation A- transition B- transcription C- transversion D- frameshift mutation 3- point mutation involve : A- change in single base pair B- deletion C- duplication D- insertion 4- what is the complementary m-RNA sequence for the DNA sequence C-A-A-G-G-T A- C-A-A-G-G-U B- G-U-U-C-C-A C- C-A-A-G-G-T D-...

ADVERTISEMENT
Free Homework Help App
Download From Google Play
Scan Your Homework
to Get Instant Free Answers
Need Online Homework Help?
Ask a Question
Get Answers For Free
Most questions answered within 3 hours.
ADVERTISEMENT
ADVERTISEMENT
ADVERTISEMENT