Gel electrophoresis is based on the fragment size. The smaller the fragment, the farther it will travel and the larger it is, the shorter it will travel. Hence if the gel electrophoresis is stopped halfway, the fragments wont get separated properly. Hence the correct answer is: not all the fragments have separated from each other in the gel yet.
If you have any query kindly comment before giving thumbs up. Thank you.
If you stopped gel electrophoresis halfway during the running time, what would you expect? not all...
At the end of gel electrophoresis, what would you expect to find? the largest fragments closest to the wells O the mid-sized fragments toward the middle of the gel the smallest fragments toward the opposite end of the gel from the loading wells O all of the above
Gel Electrophoresis of Amplified PCR Samples 9. What is Alu? 10. Why is Alu useful for studying human ancestry? 11. Why do the two possible PCR products from our lab differ in size by 300 base pairs? 12. Explain how gel electrophoresis separates DNA fragments 13. Fill in the table below. For each genotype, write how many DNA bands (fragments) you would expect to see in a gel, along with the size of each (n base pairs) Table 1. Predicted...
One strand of a DNA sequences is given below. Find the
EcoRI sites and indicate the cutting site with an arrow. Count the
number of bases in each fragment.
CP22: vne strand of a DNA sequence is given below. Find the EcoRI sites and indicate the cutting site with an arrow. Count the number of bases in each fragment. Restriction digest A: ATTGAATTCCGGTTAGCTTTAGAATTCCGCCATATGCGCAATTGGAATTCC Number of bases in each fragment: Now compare the same region of DNA from another individual. Where...
16. During electrophoresis, the gas that comes out at the positive end is: (3 pts) 17. During electrophoresis, the gas that comes out at the negative end is: (3 pts) 18. The inducer that directly causes expression of the GFP protein on the pGLO plasmid is: (3 pts) 19. A circular strand of DNA is about 5000 bps long. The enzyme Hind III cuts this plasmid at position 1500, 2700, 3600 and 4000. Predict how many fragments will appear on...
Biologists use gel electrophoresis to sort DNA segments by size. DNA segments are placed at one end of a gel. DNA is negatively charged (with a charge of two electrons per base pair). When you “run the gel” you are generating an electric field by connecting anodes and cathodes at the ends of the gel. This causes the negatively charged DNA segments to move towards the positive electrode. After running the gel, smaller DNA segments have moved farther from the...
can you please answer all three questions. Thank you so
much!!
QUESTION 3: What is the purpose of the Tris-Acetate-EDTA (TAE) buffer that the agarose gel is prepared with and submerged in for running? What would happen if you used water to prepare and run the gel instead of TAE buffer? (You should conduct an internet search to answer this question) [2 marks] QUESTION 1: Several factors (including agarose gel concentration, time and current) affect migration of DNA fragments through...
SDS Page Gel:
The provided standard protein sample for electrophoresis
consists of 9 polypeptides with molecular weights ranging from 250
to 15 KDa.
Sample 1: Protein A in a sample buffer with
B-Mercaptoethanol
Sample 2: Protein A in a sample buffer without
B-Mercaptoethanol
Sample 3: Protein B in a sample buffer with
B-Mercaptoethanol
Sample 4: Protein C in a sample buffer without
B-Mercaptoethanol
Use the picture below & the information about the proteins
above to answer the following questions.
1a....
6. You are given a mixture of proteins that you analyze by standard 2-D electrophoresis, with the following results for isoelectric points and apparent molecular weights: protein A (Mr 110,400; pl 4.60), protein B (Mr 10,100; pl 6.93), protein C (Mr 65,200; pI 7.84), and protein D (M 25,000; pI 8.15) a. After the 2-D separation, which protein will be in the upper left quadrant of the gel. given that e cathode-proximal end of the isoelectric focusing gel was on...
Question 4-12 points Biologists use gel electrophoresis to sont DNA segments by size. DNA segments are placed at one end of a gel. DNA is negatively chargod (with a charge of two electrons per base pair). When you "run the gel" you are generating an electric field by connecting anodes and cathodes at the ends of the gel This causes the negatively charged DNA segments to move towards the positive electrode. After nunning the gel, smaller DNA segments have moved...
Can
anyone show me step-by-step on how to do the agarose calculations?
This week we will run the PCR reactions on an agarose gel and analyze the results. Safety notes: Ethidium bromide is a potent mutagen. Wear gloves when handling containers containing ethidium bromide, when handling gels that have been stained in ethidium bromide, and when working with the computer attached to the gel-doc system. Protocol I. Pouring agarose gels I. Using 10x TAE, prepare 50 ml of 3% (w/v)...