1)You used pBLU as the vector for the unknown insert project. After transformation, you decide to...
1)You used pBLU as the vector for the unknown insert project. After transformation, you decide to perform a blue/white test, so you plate the transformants on LB + ampicillin with X-gal. Why is ampicillin required in this plate?
2)When designing PCR primers, which primer (forward vs reverse) anneal to which DNA strand (coding vs template)?
Homework Answers
Request Answer!
We need at least 10 more requests to produce the answer.
0 / 10 have requested this problem solution
The more requests, the faster the answer.
Add Answer to:
1)You used pBLU as the vector for the unknown insert project.
After transformation, you decide to...
Now. you should be able to answer the following questions: • How the amplification will be...
Now. you should be able to answer the following questions: • How the amplification will be done? - How you will determine your target sequence? How the amplification will be specific for certain segment? What are the requirements to carry PCR? • Suppose you perform a PCR that begins with one double-strand of the following DNA template: +5'-CTACCTGCGGGTTGACTGCTACCTTCCCGGGATGCCCAAAATTCTCGAG-3+ +3'-GATGGACGCCCAACTGACGATGGAAGGGCCCTACGGGTTTTAAGAGCTC-5'+ A. Draw one cycle of PCR reaction below the following diagram. B. Label the template DNA, the primers, and what is...
Please help with all questions. I provided all the information that I have. The sequence below...
Please help with all questions. I provided all the information that I have. The sequence below represents the genomic DNA sequence of the first 440 bp of your gene of interest (exon 1 in blue). You want to amplify this full 440 bp region by PCR, for cloning into a plasmid vector. tgaagtccaactcctaagccagtgccagaagagccaaggacaggtacggctgtcatcacttagacctcaccctgtggagccacaccctagggttggccaatctactcccaggagcagggagggcaggagccagggctgggcataaaagtcagggcagagccatctattgcttacatttgcttctgacacaactgtgttcactagcaacctcaaacagacaccatggtgcatctgactcctgaggagaagtctgccgttactgccctgtggggcaaggtgaacgtggatgaagttggtggtgaggccctgggcaggttgctatcaaggttacaagacaggtttaaggagaccaatagaaactgggcatgtggagacagagaagactcttgggtttctgataggcactgactctctctgcctattggtctattttcccaccc 1.1 Design a 20 nucleotide forward & reverse primer set that will allow you to amplify the sequence above. (note - primers should be at the beginning...
Cloning/Transformation Homework Please indicate what you would see on each media plate given the following conditions...
Cloning/Transformation Homework Please indicate what you would see on each media plate given the following conditions (blue colonies or white colonies) E. coli cell Nutrient agar plate, no ampicillin, no X- gal E. coli cell Nutrient agar plate with ampicillin added, no X-gal OM OM 01 01 E. coli cell with plasmid CO ОООО Nutrient agar plate with ampicillin & X- gal added E. coli cell with plasmid and correctly inserted Insulin gene in the multiple cloning site C LB...
12. If you used the PBLU plasmid as a vector to carry a desirable human gene...
12. If you used the PBLU plasmid as a vector to carry a desirable human gene into E. coli recipient cells. The insertion site is inside the B-galactosidase gene on the p-BLU plasmid. After the transformation, you plate the cells on LBA+amp+X-Gal to screen for E. coli cells with the desirable gene. You saw both blue and white colonies on the plate. Which type of colonies carry the desirable human gene? A. White B. Blue C. both D. neither one...
1. Create the primers to amplify the gene of interest. 1. Below is almost the full...
1. Create the primers to amplify the gene of interest. 1. Below is almost the full sequence of the coding strand of the F9 gene (exon 2-exon4) that you found in the online database (NCBI, Genomic sequence F9 gene). Some of the sequence is missing, but you know how many nucleotides are skipped. Design forward and reverse primers 18nt each for PCR that will isolate EXACTLY the sequence that is in bold typeface. Exon 2 = 164 nt Intron 2...
based on the given graph how would these be answered? sa sequence from a sheep PCR...
based on the given graph how would these be answered?
sa sequence from a sheep PCR product. The template used was genomic DNA and the forward and se primers were designed to amplify partofthe priongene, which encodes the causative agentot scrapie. is black;Cisblue; Ais green: Tisred. The forward primerwasusedasasequencing primer. TheNattheten ow means that the computer can't decide which nucleotide is at that position in the sequence because there are two peaks (red=T and blue-C) that are the same height....
QUESTION 1: You are inserting a gene into an MCS found within the LacZ gene. Using...
QUESTION 1: You are inserting a gene into an MCS found within the LacZ gene. Using blue/white colony selection, why could you assume that white colonies have modified plasmids? a. A blue colony means the LacZ reading-frame was disrupted b. A blue colony means your gene has mutations c. A white colony means the LacZ reading-frame is intact d. A white colony means the LacZ reading-frame was disrupted QUESTION 2: You are performing a PCR using primers with a sequence perfectly...
8. PCR is used to. A Diagnose genetic disease 8 Solve cnmes C Sudy gene unction...
8. PCR is used to. A Diagnose genetic disease 8 Solve cnmes C Sudy gene unction D. All of th C ONA as a template to form RINA D All of the above 7. PCR technique does not need A. Tag polymerase B Restriion encymes C Olgoucletide prmers C. A fragment of skin D. All of the above 9 PCR can be used in A Cloning B.Sequening C.Medical dagnosis&foric mine 0.PCR can make mullple copies ot A. DNA B RNA...
i need help on the whole page! 24. What is the chemical group responsible for making...
i
need help on the whole page!
24. What is the chemical group responsible for making these amino acids acidic? 25. List the 3 amino acids that can be phosphorylated using single letter names 20. If you want to mutate Tyrosine (Y) to keep it from being negatively charged, but keep it as close keep it as close in shape as possible to tyrosine, which amino acid would you change it to Use the single letter name. being negatively charged...
alllll them please all To MOST readily demonstrate transformation of bacteria in the laboratory one could...
alllll them please all
To MOST readily demonstrate transformation of bacteria in the laboratory one could extract DNA from: A) his cells and add the DNA to his cells, then grow the cells on plates with histidine B) hist cells and add the DNA to his cells, then grow the cells on plates without histidine C) lac" cells and add the DNA to lact cells, then grow the cells on plates without histidine D) amp cells and add the DNA...
Now. you should be able to answer the following questions: • How the amplification will be done? - How you will determine your target sequence? How the amplification will be specific for certain segment? What are the requirements to carry PCR? • Suppose you perform a PCR that begins with one double-strand of the following DNA template: +5'-CTACCTGCGGGTTGACTGCTACCTTCCCGGGATGCCCAAAATTCTCGAG-3+ +3'-GATGGACGCCCAACTGACGATGGAAGGGCCCTACGGGTTTTAAGAGCTC-5'+ A. Draw one cycle of PCR reaction below the following diagram. B. Label the template DNA, the primers, and what is...
Cloning/Transformation Homework Please indicate what you would see on each media plate given the following conditions (blue colonies or white colonies) E. coli cell Nutrient agar plate, no ampicillin, no X- gal E. coli cell Nutrient agar plate with ampicillin added, no X-gal OM OM 01 01 E. coli cell with plasmid CO ОООО Nutrient agar plate with ampicillin & X- gal added E. coli cell with plasmid and correctly inserted Insulin gene in the multiple cloning site C LB...
12. If you used the PBLU plasmid as a vector to carry a desirable human gene into E. coli recipient cells. The insertion site is inside the B-galactosidase gene on the p-BLU plasmid. After the transformation, you plate the cells on LBA+amp+X-Gal to screen for E. coli cells with the desirable gene. You saw both blue and white colonies on the plate. Which type of colonies carry the desirable human gene? A. White B. Blue C. both D. neither one...
1. Create the primers to amplify the gene of interest. 1. Below is almost the full sequence of the coding strand of the F9 gene (exon 2-exon4) that you found in the online database (NCBI, Genomic sequence F9 gene). Some of the sequence is missing, but you know how many nucleotides are skipped. Design forward and reverse primers 18nt each for PCR that will isolate EXACTLY the sequence that is in bold typeface. Exon 2 = 164 nt Intron 2...
based on the given graph how would these be answered?
sa sequence from a sheep PCR product. The template used was genomic DNA and the forward and se primers were designed to amplify partofthe priongene, which encodes the causative agentot scrapie. is black;Cisblue; Ais green: Tisred. The forward primerwasusedasasequencing primer. TheNattheten ow means that the computer can't decide which nucleotide is at that position in the sequence because there are two peaks (red=T and blue-C) that are the same height....
8. PCR is used to. A Diagnose genetic disease 8 Solve cnmes C Sudy gene unction D. All of th C ONA as a template to form RINA D All of the above 7. PCR technique does not need A. Tag polymerase B Restriion encymes C Olgoucletide prmers C. A fragment of skin D. All of the above 9 PCR can be used in A Cloning B.Sequening C.Medical dagnosis&foric mine 0.PCR can make mullple copies ot A. DNA B RNA...
i
need help on the whole page!
24. What is the chemical group responsible for making these amino acids acidic? 25. List the 3 amino acids that can be phosphorylated using single letter names 20. If you want to mutate Tyrosine (Y) to keep it from being negatively charged, but keep it as close keep it as close in shape as possible to tyrosine, which amino acid would you change it to Use the single letter name. being negatively charged...
alllll them please all
To MOST readily demonstrate transformation of bacteria in the laboratory one could extract DNA from: A) his cells and add the DNA to his cells, then grow the cells on plates with histidine B) hist cells and add the DNA to his cells, then grow the cells on plates without histidine C) lac" cells and add the DNA to lact cells, then grow the cells on plates without histidine D) amp cells and add the DNA...
Most questions answered within 3 hours.
-
5.) (a) How does go-back-by N ARQ work?
(b) What operations are required for CRC error...
asked 4 minutes ago -
A random sample of size n = 32 is taken from a
population with mean μ...
asked 2 minutes ago -
write a research report on the scope and potential of renewable
energy resources for the kingdom...
asked 3 minutes ago -
Find the critical value(s) for the specified Wilcoxon
signed-rank test.
Sample size = 10, two-tailed test,...
asked 7 minutes ago -
1) When the centers of two spherical masses are separated by
distance D, the masses exert...
asked 9 minutes ago -
Population Standard Deviation
5.0000
Sample Size
11
Sample Mean
54.9091
Confidence Interval
Confidence Coefficient
0.98
Lower...
asked 25 minutes ago -
Consider a t distribution with 15 degrees of freedom. Compute
P(-1.42<t<1.42). Round your answer to at...
asked 26 minutes ago -
2-chloro-2-methylpropane is classified as a ____.
primary alkyl chloride
secondary alkyl chloride
tertiary alkyl chloride
asked 24 minutes ago -
Help would be greatly appreciated
Mark each of the statements below as True (T) or False...
asked 26 minutes ago -
How the process improvement(poka-yoke, kaizen, deming cycle,
mistake-proofing, DMAIC) people can employ in their work or...
asked 28 minutes ago -
Write a program to control a bread machine. Allow the user to
input the type of...
asked 36 minutes ago -
Turn design in research is an examination of:
Question 5 options:
A)
What and how something...
asked 42 minutes ago