1. The non template DNA strand,which runs in the 5' to 3' direction is referred to as the coding strand since it contains the same nucleotide sequence in the mRNA strand.
Template strand is the term that refers to the starnd used by DNA polymerase to attach complementary bases during DNA replication this starnd is in 3' to 5' direction
So the answer will be b put complemantay pairing from 5'to 3'
Then answer will be b -5' CGGTGCATAGT-3'
2. An operon is a cluster of functionally related genes that are controlled by a shared operator.
Operons consist of multiple genes grouped together with a promoter and an operator.
3. Because the messengers RNA contains the codons transcribed from the DNA,in which need to match up to the anticodons represented on the tRNA proteins that have binding the respective amino acids.
For example AUG codon on the mRNA the anticodon will be UAC and thus thrtcorrect tRNA can bind within the ribosome which produces proteins/polypeptide chains.
Importance of mRNA
1. As mRNA is formed in nucleaus,it acts as a blueprint of DNA template and enclosed information for protein in the form of triplet base pair.
Specific mRNA plays important role as it contains information for specific protein that can be translated in cytoplasm with the help of ribosome and tRNA.
Some time mRNA plays a poly histrionic i.e it single mRNA contains information for more than one proteins.
4. Sickle cell disease is a group of disorders that affects hemoglobin the molecule in red blood cells that delivers oxygen to cells throughout the body. People with this disorder have atypical hemoglobin molecules call hemoglobin S which can distort red blood cell into sickle or present shape.
The HBB gene codes for hemoglobin a protein in red blood cells . A mutation in HBB result in a change in one of the bases in the DNA sequence from A to T. This change leads to change in amino acids. In the hemoglobin protein from glutamic acid to valine.
Sickle cell hemoglobin differs from normal hemoglobin by a single amino acid valine replaces glutamate at position 6 on the surface of the beta chain.
The template strand of a given gene includes the sequence 3'-GCCACGTATCA-5' What is the sequence of...
If the DNA template strand sequence at a particular region of a gene is 3-GGA-5. What amino acid would this result in after transcription and translation? Pro (Proline) Ser (Serine) Val (Valine) Arg (Arginine) Question 20 1 pts What is created during transcription? a strand of codons O a strand of tRNA a strand of anticodons a polypeptide • a strand of DNA IPS Which letter (representing a phase of the cell cycle) would you observe (S phase) synthesis and...
4. The non-template strand sequence of a eukaryotic gene is given below. The promoter sequence is underlined. The +1 nucleotide is shown in boldface and red. a. Write the sequence of the mRNA that would be produced by this gene. You may assume that the gene ends at the end of the sequence shown, so you do not need to look for transcription termination signals. You may also assume that it has no introns 5' GCGGTATAACAGGACAGGCTGCATGAGAAGATTCCATCTTCCAGATCACTGTCCTTCTAGCCATGGAAAATGA CGAATTGTGACTGCCCCTGC3' mRNA (make sure...
The template strand of a given gene includes the sequence 3'-GCCACGTATCAG-5'. For each one, be sure to indicate 5' and 3' ends (DNA & RNA) and N and C termini (polypeptide). What is the sequence of the nontemplate strand (a), mRNA sequence made (b) and polypeptide made (c)? Hint: They are aligned in a way that you don't have to worry about the direction, because polynucleotides grow from 5' to 3' direction. (7 pts) Second base of RNA codon 000...
You have the following mRNA sequence: 5’-GCAUGAUAUGCGAGCUAHCAUGACGU-3’ What is the DNA coding strand, template strand, and tRNA sequence. Where is the start and stop codons and provide the resultant polypeptide sequence
Gene Expression Exercise Located below is a gene sequence from the coding strand of DNA 5’ATGCCCGGGTGTCGTAGTTGA3’ Complete the complementary sequence for the template strand. _________________________________________________ What would the mRNA be based upon the template strand above? mRNA___________________________________________ What would the primary linear structure of the protein be based upon the mRNA strand above? Intro to Biology 1005
Table 1B: Protein Synthesis with 2nd DNA Template Strand DNA Codons in the 2nd Template Strand mRNA Sequence (List codons) Amino Acids in the Protein **Use the Genetic Code Chart on page 217 to determine the amino acids that will be placed in the protein Questions: 19. The three letter "code words of DNA and RNA that specify amino acids are called: A. codons B. promoters C. Introns D. anticodons 20. Proteins are composed of building blocks called: A. fatty...
The NONTEMPLATE strand of a gene includes the following the
following sequence: 5'-AACAGCATCACC-3'. What amino acid sequence
will be generated when this gene is transcribed and translated?A. N-val-ala-asp-gly-CB. N-gly-asp-ala-val-CC. N-thr-ile-ser-asn-CD. N-pro-leu-arg-gln-CE. N-asn-ser-ile-thr-C
Given the template DNA sequence below: 3'-CCACCTTCTATACTTCGCGGAATGCCGGTCCATGTAGGTTCACATTAGCGT-5' 6. An error occurred in DNA replication, A was incorporated in the place of T (indicated in yellow color in the aforementioned sequence) from the gene. Write the corresponding DNA template strand and transcribe the mutated mRNA strand, then determine the amino acid sequence of the mutant protein. If a stop codon is not present, create one by adding sequences to the gene and mRNA.
DNA sequence of a one strand of a gene to be transcribed is: 3’ — AGTCCGATGGGCT GA — 5’ the sequence of the MRNA is: 3’ — AGUCCGAUGGGCTGA — 5’ the sequence of the DNA strand shown above is that of the: a. template strand b. coding strand
1. Use the provided DNA template to synthesize a complementary strand. (1 point)5’ ATGCGTATACGTTCCGTCGCCTAA 3’ 2. What enzyme facilitates the complementary base pairing used to make the complementary strand in question #1. 3. At what site on the DNA molecule does transcription initiate? At what site on the DNA does transcription terminate? 4. Use the DNA molecule from question #1 and transcribe an mRNA molecule. Show the nucleotide sequence of the mRNA molecule. 5. What enzyme is responsible for transcription?...