Homework Answers
1. The two DNA strands run anti-parallel to each other, one in the 5' > 3' direction and the other in the 3' >5' direction.
5'- ATGCCACGTATCTGC -3'
3'- TACGGTGCATAGACG -5'
2. Transcription proceeds in the 5' > 3' direction using the template or the 3' > 5' strand of DNA. The 5' > 3' strand is the coding strand and has the same sequence as that of the mRNA except for the Uracil bases which are found in RNA instead of Thymine bases in the DNA.
Non-template strand: 5'- ATGCCACGTATCTGC -3'
Template strand: 3'- TACGGTGCATAGACG -5'
3. The mRNA sequence can be written as : 5'- AUGCCACGUAUCUGC -3'
Add Answer to:
Please show work
In the following diagram of a DNA fragment: 5. (1) label the two...
3. Shown below is a double stranded DNA. Replicate this DNA fragment and show the products...
3. Shown below is a double stranded DNA. Replicate this DNA fragment and show the products formed from this replication. Remember, in replication, each strand is copied into a new daughter strand. In your answer, indicate which strands are the new daughter strands (mark with D) and which strands are the already existing parent strands (mark with P as shown below). Label the 5’ and 3’ ends of all DNA. HINT: You should have 2 double-stranded DNA fragments after replication....
please help The following diagram shows a fragment of transcribed DNA, and the upper strand is...
please help
The following diagram shows a fragment of transcribed DNA, and the upper strand is the non-template strand: 5 TAACGG 3 3' ATTGCC 5 The transcribed RNA can be represented by? d. 5' UAACGG 3 c. 5' AUUGCC 3 O O b. 5 TAACGG 3 a. 5' AUUGCC 3 The primary structure of a polypeptide is: O a) the sequence of nucleotides on the DNA molecule that encodes the protein. b) the linear sequence of amino acids that constitutes...
In the following diagram, A and B are two Okazaki fragments generated during DNA replication. Open...
In the following diagram, A and B are two Okazaki fragments
generated during DNA replication. Open boxes represent the primers
and dotted lines represent the newly synthesized DNA strands.
a. To which direction (left or right) is the replication fork is
moving? (1 mark)
b. Which Okazaki fragment is made first in the diagram? Explain.
(2 marks)
c. (i) Which enzyme in E. coli synthesizes the primers on
Okazaki fragments? (1 mark)
(ii) What is the difference of this enzyme...
In the following diagram, A and B are two Okazaki fragments generated during DNA replication. Open...
In the following diagram, A and B are two Okazaki fragments generated during DNA replication. Open boxes represent the primers and dotted lines represent the newly synthesized DNA strands. B ---- Template DNA a. To which direction (left or right) is the replication fork is moving? (1 mark) b. Which Okazaki fragment is made first in the diagram? Explain. (2 marks) c. (i) Which enzyme in E. coli synthesizes the primers on Okazaki fragments ? (1 mark) (ii) What is...
The following is a fragment of double stranded DNA . The bottom strand is the template...
The following is a fragment of double stranded DNA . The bottom strand is the template strand. It encodes a hypothetical 6 amino protein & includes the start (initiator) codon, a small amount of 5’ UTR, and a small amount of 3’ UTR TTGGCAATGTGATCCCTTGTGCGGTACCACT AACCGTTACACTAGGGAACACGCCATGGTGA (Template strand) The bottom strand is the template strand and the RNA polymerase will always move from right-to-left, this is the direction of RNA synthesis RNA transcript compares to the non-template strand by being exactly...
Name: Section Transcription Worksheet (5 Points) Instructions: Below is the same DNA molecule from above. Now,...
Name: Section Transcription Worksheet (5 Points) Instructions: Below is the same DNA molecule from above. Now, it is preparing Renes in this region. Using pencil draw in and label the following items according cule from above. Now, it is preparing for transcription of the and label the following items according to the instructions. 1) Label template and non-template strands 2) Label 5' and 3' ends of template and non-template strand 3) Draw in and label RNA polymerase 4) Label transcription...
In the following diagram, label the following: leading and lagging strand
In the following diagram, label the following: leading and lagging strand, Okazaki fragment, DNA polymerase, DNA ligase, helicase, RNA primase, singlestrand binding proteins, RNA primer, replication fork, topoisomerase and the 5' and 3' ends of strands.
Please answer only if you know how to!!! Please follow the directions and label clearly! On...
Please answer only if you know how to!!!
Please follow the directions and label
clearly!
On the next page is a small segment of DNA that includes one gene. The list below contains all th e information that must be encoded in that gene in order for both transcription and translation to occur correctly 1. On the DNA, LABEL the location of every item on the list. Hint: some locations will be approximate 2. In the space provided below the...
Label the 5' and 3' ends of the template and primer strands in this image, from...
Label the 5' and 3' ends of the template and primer strands in
this image, from left to right in the image.
Label the 5' and 3' ends of the template and primer strands in
this image, from left to right in the image.
template: 3' to 5'
primer: 3' to 5'
template: 5' to 3'
primer: 3' to 5'
template: 3' to 5'
primer: 5' to 3'
template: 5' to 3'
primer: 5' to 3'
Incoming nucleotide Template strand...
Consider the following segment of DNA is part of a gene,
Consider the following segment of DNA is part of a gene, Left 5'.... ACTGACTGACAGTC..3' 3'.... TGACTGACTGTCAG... 5' RIGHT during RNA transcription, this double-strand molecule is separated into two single strands from the right to the left and the RNA polymerase is also moving from the right to the left of the segment. Please predict the peptide sequence(s) produced from the mRNA transcribed from this segment of DNA. (Hint: First determine the mRNA sequence, then use the genetic codon table to...
please help
The following diagram shows a fragment of transcribed DNA, and the upper strand is the non-template strand: 5 TAACGG 3 3' ATTGCC 5 The transcribed RNA can be represented by? d. 5' UAACGG 3 c. 5' AUUGCC 3 O O b. 5 TAACGG 3 a. 5' AUUGCC 3 The primary structure of a polypeptide is: O a) the sequence of nucleotides on the DNA molecule that encodes the protein. b) the linear sequence of amino acids that constitutes...
In the following diagram, A and B are two Okazaki fragments
generated during DNA replication. Open boxes represent the primers
and dotted lines represent the newly synthesized DNA strands.
a. To which direction (left or right) is the replication fork is
moving? (1 mark)
b. Which Okazaki fragment is made first in the diagram? Explain.
(2 marks)
c. (i) Which enzyme in E. coli synthesizes the primers on
Okazaki fragments? (1 mark)
(ii) What is the difference of this enzyme...
In the following diagram, A and B are two Okazaki fragments generated during DNA replication. Open boxes represent the primers and dotted lines represent the newly synthesized DNA strands. B ---- Template DNA a. To which direction (left or right) is the replication fork is moving? (1 mark) b. Which Okazaki fragment is made first in the diagram? Explain. (2 marks) c. (i) Which enzyme in E. coli synthesizes the primers on Okazaki fragments ? (1 mark) (ii) What is...
Name: Section Transcription Worksheet (5 Points) Instructions: Below is the same DNA molecule from above. Now, it is preparing Renes in this region. Using pencil draw in and label the following items according cule from above. Now, it is preparing for transcription of the and label the following items according to the instructions. 1) Label template and non-template strands 2) Label 5' and 3' ends of template and non-template strand 3) Draw in and label RNA polymerase 4) Label transcription...
In the following diagram, label the following: leading and lagging strand, Okazaki fragment, DNA polymerase, DNA ligase, helicase, RNA primase, singlestrand binding proteins, RNA primer, replication fork, topoisomerase and the 5' and 3' ends of strands.
Please answer only if you know how to!!!
Please follow the directions and label
clearly!
On the next page is a small segment of DNA that includes one gene. The list below contains all th e information that must be encoded in that gene in order for both transcription and translation to occur correctly 1. On the DNA, LABEL the location of every item on the list. Hint: some locations will be approximate 2. In the space provided below the...
Label the 5' and 3' ends of the template and primer strands in
this image, from left to right in the image.
Label the 5' and 3' ends of the template and primer strands in
this image, from left to right in the image.
template: 3' to 5'
primer: 3' to 5'
template: 5' to 3'
primer: 3' to 5'
template: 3' to 5'
primer: 5' to 3'
template: 5' to 3'
primer: 5' to 3'
Incoming nucleotide Template strand...
Most questions answered within 3 hours.
-
Write a chemical equation for these reactions. (Use
the lowest possible whole number coefficients.) Include
states-of-matter...
asked 1 hour ago -
For each of the Z-scores below, determine two probabilities
(show four three decimal places): (1) the...
asked 1 hour ago -
Oxidative phosphorylation is achieved through chemiosmotic
coupling, which turns chemical energy into osmotic potential energy
that...
asked 4 hours ago -
Hollywood Shoes would like to maintain their cash account at a
minimum level of $64,000, but...
asked 4 hours ago -
Proteins CtrA-P, DnaA, and GcrA behave similarly to what
molecule in the Eukaryotic Cell Cycle?
asked 4 hours ago -
TRUE OR FALSE
In case of a competitive tender procedure, in the request for
quotation, the...
asked 4 hours ago -
I am a little behind please provide some explanation, will
provide thumbs up.
This question considers...
asked 4 hours ago -
Let say the utility function as U(X,Y) = lnX + Y. Show that the
marginal rate...
asked 4 hours ago -
A current of I=8.0A is flowing in a typical extension cord of
length L=3.00m. The cord...
asked 4 hours ago -
1. When balancing the equation H2SO4 (aq) + NaOH (aq) →
Na2SO4(aq) + H2O(aq), would you...
asked 5 hours ago -
Provide a definition of “classification hierarchy” and
illustrate your definition with an example of how and...
asked 5 hours ago -
1. Describe the four main green solvents. Provide one example of
the use of each solvent....
asked 5 hours ago