Question

A strain of yeast translates mRNA into protein with a high level of inaccuracy. Individual molecules of a particular protein
0 0
Add a comment Improve this question Transcribed image text
Answer #1

Question

The likely cause of variation is mutation in the tryptophan -tRNA synthetase that decreases it's ability to distinguish between different amino-acid. This is because mutation in the tryptophan -tRNA synthetase will lead to its pairing with tryptophan Codon and cause a variety of substitutions occupied by tryptophan. The option c is incorrect because this mutation will lead to the substitutions of amino-acid would take place at many amino acid and not only to tryptophan. Hence, option e is correct.

Add a comment
Know the answer?
Add Answer to:
A strain of yeast translates mRNA into protein with a high level of inaccuracy. Individual molecules...
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Not the answer you're looking for? Ask your own homework help question. Our experts will answer your question WITHIN MINUTES for Free.
Similar Homework Help Questions
  • PLEASE COMPUTER TYPED* OR VERY CLEAR HANDWRITING with details 1. Radioactive (14C) uridine (lots of it)...

    PLEASE COMPUTER TYPED* OR VERY CLEAR HANDWRITING with details 1. Radioactive (14C) uridine (lots of it) is added to a growing culture of bacteria for 10 seconds and then the drug rifamycin is added (rifamycin blocks the initiation of transcription, but not continued elongation of RNA polymerases that have already begun transcribing). At two-minute intervals, 1 ml samples are removed and placed on ice. The bacteria are lysed (broken open) and an enzyme is added that will chew up all...

  • please explain how to solve this problem, the answer is provided 9. Peptides: (20 pts.). A...

    please explain how to solve this problem, the answer is provided 9. Peptides: (20 pts.). A polypeptide (X) gives 7 fragments when treated with chymotrypsin (A-G). The same peptide also gives 9 fragments when treated with trypsin (I- IX). After Chymotrypsin A) Thr-Thr-Tyr-Ala-Gly-Phe-Phe-Ile-Asp- Lys B) Ala-Cys-Pro-Leu-Tyr-Gin-lle-Arg C) Met-Ser-Thr-Tyr-Pro-Gly-Arg D) Cys-Leu-Val-Phe-Ile-Lys E) Leu-Ala-Trp-Gly-Val F) Ser-Phe-Ala-Pro-Lys G) Met-Asp-Lys Afier Trypsin I) Ala-Pro-Lys-Met-Asp-Lys-Thr-Thr-Tyr II) Pro-Gly-Arg-Cys-Leu-Val-Phe III) Ile-Lys-Ala-Cys-Pro-Leu-Tyr IV) Ile-Asp-Lys-Met-Ser-Thr-Tyr V) Gin-Ile-Arg-Leu-Ala-Trp VIAla-Gly-Phe VII) Gly-Val VIII) Ser-Phe LX) Phe A) What is the primary...

  • 2. On the mRNA codon table, the first nucleotide in mRNA is to the left, the...

    2. On the mRNA codon table, the first nucleotide in mRNA is to the left, the second is above, and third is to the right. On the sequence, the 5'cap is indicated by (5'). The poly (A) tail is not shown. Use the codon table to translate this short mRNA. Mark the codons and write the amino acid sequence beneath them. (5') CGUUACAAUGUAUCGCGCGGUACUCGGCAAAGUGCCCUGAAUAGAGUUGGUA (3') 3. DNA polymerase made a mistake and added a C on the DNA template strand. In...

  • PLEASE HELP OCHEM QUESTION 1. In the following protein, identify the type of bonding or interaction...

    PLEASE HELP OCHEM QUESTION 1. In the following protein, identify the type of bonding or interaction that is responsible for holding the two peptide chains together at each amino acid pair, above (A) and below (B). Gly - Ala - Ser - Cys - Val - Asp - Leu - Thr - His - Ile-Tyr-Glu - Phe - Lys - Cys - Met - Asn Val - Leu -Gin-Cys - Pro-Lys - Met - Tyr - Asp -Phe-Asn-Lys - Ile...

  • The following is a short mRNA in its entirety: Gm7 CAG GAU GCC CGU AAC CGC...

    The following is a short mRNA in its entirety: Gm7 CAG GAU GCC CGU AAC CGC CAC CGC CGA UGU CAU AAG AUA AAA AAA AAA A short little protein is translated from it; what is the most likely AA sequence? A. Gly Cys Pro End Pro Pro Pro Pro Met Ser B. Met Pro Val Thr Ala Thr Ala Asp Val Ile Arg C. Met Ser D. Arg Met Pro Val Thr Ala Thr Ala Asp Val Ile Arg...

  • How many amino acids are there in the disease causing variant of the Amyloid-beta (Ab) peptide?...

    How many amino acids are there in the disease causing variant of the Amyloid-beta (Ab) peptide? Determine which of these four peptides is most likely to become a beta sheet. Lys-Thr-Val-Ile-Trp-Pro-Phe-Tyr-Ile-Gln-Ile-Gly Arg-Ser-Tyr-Glu-Gly-Leu-Lys-Arg-Ile-Ala-Glu-Ser Ala-Glu-Met-Leu-Gln-Lys-Arg-Gly-Cys-Gly-Asp-Glu Met-Leu-Lys-Ala-Ser-Ala-Leu-Glu-Lys-Leu-Ser-Glu

  • What two restriction enzymes could you use if you wanted to produce a protein that was fused to a GST-tag that could be removed using thrombin? Would this experimental design place any other tags on y...

    What two restriction enzymes could you use if you wanted to produce a protein that was fused to a GST-tag that could be removed using thrombin? Would this experimental design place any other tags on your protein? Here is the vector: T7 promoter lac operator Xbal rbs Ndel AATTAATACGACTCACTATAGGGGAATTGTGAGCGGATAACAATTCCCCTCTAGAAATAATTTTGTTTAACTTTAAGAAGGAGATATACATATGTCCCCT Met Ser Pro GST Ta His TagSacl ATACTAGGTTAT.627bp...GACCATCCTCCAAAATCGGATGGTTCAACTAGTGGTTCTGGTCATCACCATCACCATCACTCCGCGGGTCTGGTGCCACGCGGTAGT lle Leu Gly Tyr.. .209aa. . . Asp His Pro Pro Lys Ser Asp Gly Ser Thr Ser Gly Ser Gly His His...

  • "A protein is made from a messenger RNA of the following sequence. What is the sequence...

    "A protein is made from a messenger RNA of the following sequence. What is the sequence of amino acids for this protein? (Remember, a start and a stop codon are needed for a protein to be made). 3' G C C G A U G G A U G A A G U U U U A A A G U A A U A G C A A U G G A G G A C 5'" (amino) met...

  • Met-Ala-Arg-Tyr-Ala-Asn-Asn-Glu__Lys-Glu-Leu-Leu-Tyr__Arg-Tyr-Ala-Asn__Phe-Leu-Ala-Asn-Asn-Ile-Gly-Ala-Asn__Ile-Ser__Ile-Asn-Thr-Glu-Arg-Glu-Ser-Thr-Glu-Asp__Ile-Asn__ His-Glu-Arg__Phe-Ala-Thr-His-Glu-Arg-Ser__Thr-Arg-Ile-Gly-Leu-Tyr-Cys-Glu-Arg-Ile-Asp-

    Met-Ala-Arg-Tyr-Ala-Asn-Asn-Glu__Lys-Glu-Leu-Leu-Tyr__Arg-Tyr-Ala-Asn__Phe-Leu-Ala-Asn-Asn-Ile-Gly-Ala-Asn__Ile-Ser__Ile-Asn-Thr-Glu-Arg-Glu-Ser-Thr-Glu-Asp__Ile-Asn__ His-Glu-Arg__Phe-Ala-Thr-His-Glu-Arg-Ser__Thr-Arg-Ile-Gly-Leu-Tyr-Cys-Glu-Arg-Ile-Asp-Glu__Leu-Glu-Val-Glu-Leu-Ser__Ser-Ile-Asn-Cys-Glu__His-Glu-__His-Ala-Pro-Pro-Ile-Leu-Tyr__Glu-Ala-Thr-Ser__Val-Ala-Asn-Ile-Leu-Leu-Ala__Cys-Ala-Lys-Glu-__Ala-Asn-Asp__Pro-Glu-Cys-Ala-Asn__Pro-Ile-Glu__Trp-Ile-Thr-His__Phe-Arg-Ile-Glu-Asp__Cys-His-Glu-Glu-Ser-Glu-Cys-Ala-Lys-Glu__Ile-Cys-Glu__Cys-Arg-Glu-Ala-Met__Glu-Val-Glu-Arg-Tyr-Asp-Ala-Tyr__Ala-Asn-Asp__Ser-His-Glu__Ile-Ser__Asp-Glu-Val-Ala-Ser-Thr-Ala-Thr-Glu-Asp__Thr-His-Ala-Thr__Asp-Ile-Ser-Glu-Ala-Ser-Glu-Ser__Leu-Ile-Lys-Glu__His-Glu-Ala-Arg-Thr__Asp-Ile-Ser-Glu-Ala-Ser-Glu__Ser-Leu-Glu-Glu-Pro__Ala-Pro-Asn-Glu-Ala__Ser-Glu-Val-Glu-Arg-Glu__Trp-Glu-Ile-Gly-His-Thr__Gly-Ala-Ile-Asn__Trp-Ile-Leu-Leu__Ala-Arg-Ile-Ser-Glu__Ile-Phe__His-Glu__Lys-Glu-Glu-Pro-Ser__Thr-His-Ile-Ser__Glu-Ala-Thr-Ile-Asn-Gly__Pro-Ala-Thr-Thr-Glu-Arg-Asn__Tyr-Glu-Thr__Ile-Phe__His-Glu__Trp-Trp-Trp-Trp-Ile-Ile-Ile-Ile-Ile-Leu-Leu-Leu-Leu-Leu-Ser-Ser-Ser-Ser__Cys-His-Ala-Asn-Gly-Glu__Ile-Asn__His-Ile-Ser__Leu-Ile-Phe-Glu-Ser-Thr-Tyr-Leu-Glu__His-Glu__Cys-Ala-Asn__Ser-Thr-Ile-Leu-Leu__Arg-Glu-Met-Ala-Ile-Asn__His-Glu-Ala-Leu-Thr-His-Tyr__Ser-Ala-Ser-Ser-Tyr__Ala-Asn-Asp__Ala-Leu-Arg-IleGly-His-Thr 1.) Write out the 1 letter amino acid abbreviation for each of the three-letter amino acid abbreviated words listed in the given sequence. The __ indicates a space in between the words. Use www.expasy.org and other bioinformatic tools to generate the following bioinformatic data for the given polypeptide sequence. You must give the name and link to the program you used to generate the data: 2.) Compute the pI and Mw (isoelectric point and molecular mass, respectively) of...

  • Question 10 (15 points) Given the following sequence for a template strand of DNA 3 -...

    Question 10 (15 points) Given the following sequence for a template strand of DNA 3 - ATACTTTGTCGAGACCCGCTTCTTGCAGACTGGG A. Provide the mRNA sequence following transcription (include polarity) B. Provide the amino acid sequence using either the one letter or three letter abbreviations. Include polarity (N-or C-terminus) and be careful to start in the correct place: C. What if the "C" underlined above was changed to a T. What is the new codon? How does that affect the amino acid sequence? What...

ADVERTISEMENT
Free Homework Help App
Download From Google Play
Scan Your Homework
to Get Instant Free Answers
Need Online Homework Help?
Ask a Question
Get Answers For Free
Most questions answered within 3 hours.
ADVERTISEMENT
ADVERTISEMENT
ADVERTISEMENT