The following is a short mRNA in its entirety:
Gm7 CAG GAU GCC CGU AAC CGC CAC CGC CGA UGU CAU AAG AUA AAA AAA AAA
A short little protein is translated from it; what is the most likely AA sequence?
A. Gly Cys Pro End Pro Pro Pro Pro Met Ser
B. Met Pro Val Thr Ala Thr Ala Asp Val Ile Arg
C. Met Ser
D. Arg Met Pro Val Thr Ala Thr Ala Asp Val Ile Arg
E. Gln Asp Ala Arg Asn Arg His Arg Arg Cys His Lys Ile Lys Lys Lys
The following is a short mRNA in its entirety: Gm7 CAG GAU GCC CGU AAC CGC...
The next DNA sequence is the MATRICE strand of a small gene. What is the complete amino acid sequence of the encoded peptide? GTCATGGCAACATAG 5'-3 Standard Genetic Code First position (5'end) U Second position UAU Tyr UAC Tyr UCA Ser UAA StopUGA Stop UAG Stop UUU Phe UUC Phe UUA Leu UUG Leu UGU Cys UGC Cys UCU Ser UCC Ser UCG Ser UGG Trp CUU Leu CUC Leu CUA Leu CUG Leu CCU Pro CCC Pro CCA Pr CCG...
Question 10 (15 points) Given the following sequence for a template strand of DNA 3 - ATACTTTGTCGAGACCCGCTTCTTGCAGACTGGG A. Provide the mRNA sequence following transcription (include polarity) B. Provide the amino acid sequence using either the one letter or three letter abbreviations. Include polarity (N-or C-terminus) and be careful to start in the correct place: C. What if the "C" underlined above was changed to a T. What is the new codon? How does that affect the amino acid sequence? What...
If mutations occur at random, and changes to 1st or 2nd "letter" of a codon usually changes the amino acid coded for, but changes to the 3rd "letter" rarely do, roughly what % of mutations should be synonymous? Second АТ G UUU Phe UCU Ser UAU Tyr UGU Cys U 0 C | Phe UCC Ser UAC Tyr UGC Cys C Leu UCA Ser UAA Stop UGA Stop UUG Leu UCG Ser UAG Stop UGG Trp G CUU Leu CCU...
The following genomic DNA sequence comes from the first exon of a human gene and contains the 3'-end of the 5'-untranslated region and the start of a long open reading frame that codes for 200 amino acids (a.k.a. coding sequence). Note: There are no introns in this short portion and only one strand of the genomic DNA is shown. Which of the following answers lists the first three amino acids of the translated protein correctly? Seconed Position tyr ser leu...
10. (20 points) Which of the restriction nucleases listed below can potentially cleave a segment of cDNA that encodes the peptide KIGDACF? You must show your work. The Genetic Code с Т А Т UUU Phe (F) UCU Ser (S) UAU Tyr ( Y UGU Cys (C) UUC - UCC UAC. UGC. UUA Leu (L) UCA UAA Stop UGA Stop UUG- UCG UAG Stop UGG Trp (W) CUU Lệu U CCU Pro (P) CAU His (H) CGU Arg (R) CUC...
The sequence below represents an eukaryotic gene which underwent a mutation (maroon). The arrow displays the transcriptional start site, as discussed during the class. (a) What is the sequence of the RNA that is transcribed? Write the sequence as 5' to 3: 5'CAGTACTATCCAAGACATGGCGACA 3' 3' GTCATGATAGGTTATGTACCGCTGT 5' -3. The RNA sequence is: 5'- (b) Write the peptide sequence that will be translated (if any) when this gene gets transcriptionally active. Use the genetic code provided below, and write the sequence...
If the sequence of an mRNA molecule is: 5' AUG GGA UUU CGA 3' (a) Give the sequence of the template strand of DNA. (Please indicate where the 5' and 3" ends are located) (1.5 marks) (b) Give the sequence of the non-template strand of DNA. (Please indicate where the 5' and 3" ends are located) (1.5 marks) (c) Give the amino acid sequence. (1.5 marks) You will require the following genetic code to answer this question. Second letter с...
7. (2 pts) Below is a DNA sequence encoding an mRNA strand. What are the first four amino acids that this sequence codes for? (Not that the coding strand has been labeled). 5'-TACTTCTGGCATATC-3' 3'-ATGAAGACCGTATAG-5' (coding) Second letter C AG UUU Phe UCU) UAU Tyrac Cys UUCS Ser UUG UACJ'Y UAA Stop UGA Stop UAG Stop UGG Trp CGU CAC) CGC CGA CGG CAU-His CUU CUC Leu CUA CUG J Pro CAAG CAGGI First letter DUO DOCUDUCUDUCU Third letter ACU AAU...
5' or or Using the codon table provided, fill in the missing entries in the following table (yellow boxes with numbers). Assume that the reading frame is fromleft to right(and the start codon is not SHOWN here, but EXISTS upstream [to the left] of the sequence shown here) and that columns represent transcriptional and translational alignments. 5. Strand ID? 3' 1 3 4 5 6 A T G | I | G | 15 16 7. 14 17 དུ་ U...
all of them please Question 12 (1 point) Which of the following conditions would kill amp' lac his bacteria? amp = ampicillin (an antibiotic), lac = lactose (a carbohydrate), his = histidine (an amino acid) A) growing the bacteria in media that contained ampicillin, had lactose as the sole metabolic carbon source, and contained the amino acid histidine. B) growing the bacteria in media that contained ampicillin, had lactose as the sole metabolic carbon source, but did not contain the...