If the following mRNA code was synthesized, what polypeptide sequence would be synthesized? Use the attached...
If the following mRNA code was synthesized, what polypeptide sequence would be synthesized? Use the attached genetic code to help you with your answer.
5' ACUGAUGCAACGCUAACAUAA 3'
(use the 3-letter abbreviation for the amino acids and separate each amino acid with a "-". i.e. met-pro-phe-glu"
Homework Answers
By using the three letter genetic code rule the possible amino acid sequence from the following sequence
5' ACUG AUGCAACGCUAACAUAA 3'
The first amino acid in any polypeptide chain is methionine coded by AUG and it ends when stop codons UAA, UGA and UAG comes in the mRNA chain. CAA codes for Glutamine amino acid and CGC codes for Arginine
So the polypeptide chain from this coding frame is met-Gln-Arg. As stop codon UAA is present after CGC which is coding for Arginine the polypeptide chain synthesis stops here.
Add Answer to:
If the following mRNA code was synthesized, what polypeptide
sequence would be synthesized? Use the attached...
How many different mRNA sequences can code for a polypeptide chain with the amino acid sequence...
How many different mRNA sequences can code for a polypeptide chain with the amino acid sequence Met - Leu - Arg? Be sure to include a stop codon. Explain your answer! 5′ ...GGAGCUCGUUGUAUU... 3′ Is this sequence RNA or DNA? How can you tell? Which amino acids are encoded, if the reading frame is as shown, starting from the correct end? What would be the effect on the amino acid sequence if the sequence were changed to 5′ GGAGACUCGUUGUAUU 3′?...
Hello please please help !! Thank you!! Please and thank you soo much!!! Question Completion Status:...
Hello please please help !! Thank you!!
Please and thank you soo
much!!!
Question Completion Status: Question 10: The genetic code consists of 64 triplets of nucleotides (called codons). Each codon (with the exception of the 3 stop codons) encodes for one of the 20 amino acids used in the synthesis of proteins. This produces some redundancy in the code as most amino acids are encoded by more than one codon. One codon, AUG serves two related functions: it signals...
15. Transcribe into mRNA and then translate into amino acids (protein) the following DNA sequence TAC...
15. Transcribe into mRNA and then translate into amino acids (protein) the following DNA sequence TAC ATG TCT AGG ATC. Write out the tRNA anticodons for each of the 5 codons as well. What is the complementary DNA sequence for the above DNA (the complementary sequence would be produced in DNA replication)? Suggested Format: DNA: TAC ATG TCT AGG ATC. Complementary: mRNA based on DNA: TRNAs that would pair with mRNA (the anticodon): Amino Acid Sequence: To transcribe the sequence...
Question Give an mRNA sequence that will code for synthesis of metenkephalin. Tyr-Gly-Gly-Phe-Met Select codons from the following table. If more than one codon is possible for a given amino acid, ch...
Question Give an mRNA sequence that will code for synthesis of metenkephalin. Tyr-Gly-Gly-Phe-Met Select codons from the following table. If more than one codon is possible for a given amino acid, choose only one If there are fewer than 8 amino acids in the peptide, leave the corresponding codons blank. Enter your answer in ALL CAPS, ie, "ATG" not "atg" Third base (3" end) First base (5' end) Second baseUCAG Phe Phe Leu Leu SerSer Ser Ser U Leu Leu...
This sequence is RNA because:
20. This sequence is RNA because:A) it is single stranded.B) it contains U (uracil) and no T (thymine).C) it runs in a 5' to 3' direction.D) it codes for amino acids.E) it is a small molecule.21. Which amino acids does this sequence code for, if the reading frame is as shown, starting from the correct end? A) gly-ala-arg-cys-ile...B) pro-arg-ala-thr-stopC) met-asn-glu-leu...D) glu-leu-val-val-phe...E) leu-glu-gln-his-asn...22. If the sequence gets changed to 5' ... GGAGACUCGUUGUAUU... 3'. What would be the effect on the amino...
What amino acid sequence does the following mRNA nucleotide sequence specify? 5′−AUGAACCUAUGC−3′ Express the sequence of...
What amino acid sequence does the following mRNA nucleotide sequence specify? 5′−AUGAACCUAUGC−3′ Express the sequence of amino acids using the three-letter abbreviations, separated by hyphens (e.g., Met-Ser-Thr-Lys-Gly).
QUESTION 8 Using the altered mRNA and the genetic code, provide the sequence of amino acids...
QUESTION 8 Using the altered mRNA and the genetic code, provide the sequence of amino acids in the peptide chain created. c A G UUU UẬC Phe UUA UAU Ty lucccys UAA Stop UGA Stop A UAG Stop UGG Trp UUG Leu CUU CUC Leu CUA CCA Pro CUG CACCI CCG) ACU ACC ACA ACG sucu suco DUCU BUCO AUU AUC File AUA AUG Met GCU GCC GAC ASP GCA GUG GCG) GAG GUGGAGI GGG) Click Save and Submit to...
What amino acid would the Manticodon code for RNA codon table 2nd position Tot position СТА...
What amino acid would the Manticodon code for RNA codon table 2nd position Tot position СТА Tyr Phe Phe > eu eu Oulaa Jooo 9999 stop stop eu eu eu Let 0 - puchbucobucusura BER < Val Val Asp Ala Asp Ala Glu Ala Glu Amino Acids Keu Pro Pro His Weu Leu Gin lle Pro Thr Thr Thr Thr Asn Asn lle Ser Ser Arg lle Met Lys Lys bucoucouco Arg > Asp Asp Val Val Val Val Ala...
Question 10 (15 points) Given the following sequence for a template strand of DNA 3 -...
Question 10 (15 points) Given the following sequence for a template strand of DNA 3 - ATACTTTGTCGAGACCCGCTTCTTGCAGACTGGG A. Provide the mRNA sequence following transcription (include polarity) B. Provide the amino acid sequence using either the one letter or three letter abbreviations. Include polarity (N-or C-terminus) and be careful to start in the correct place: C. What if the "C" underlined above was changed to a T. What is the new codon? How does that affect the amino acid sequence? What...
If the sequence of an mRNA molecule is: 5' AUG GGA UUU CGA 3' (a) Give...
If the sequence of an mRNA molecule is: 5' AUG GGA UUU CGA 3' (a) Give the sequence of the template strand of DNA. (Please indicate where the 5' and 3" ends are located) (1.5 marks) (b) Give the sequence of the non-template strand of DNA. (Please indicate where the 5' and 3" ends are located) (1.5 marks) (c) Give the amino acid sequence. (1.5 marks) You will require the following genetic code to answer this question. Second letter с...
Hello please please help !! Thank you!!
Please and thank you soo
much!!!
Question Completion Status: Question 10: The genetic code consists of 64 triplets of nucleotides (called codons). Each codon (with the exception of the 3 stop codons) encodes for one of the 20 amino acids used in the synthesis of proteins. This produces some redundancy in the code as most amino acids are encoded by more than one codon. One codon, AUG serves two related functions: it signals...
15. Transcribe into mRNA and then translate into amino acids (protein) the following DNA sequence TAC ATG TCT AGG ATC. Write out the tRNA anticodons for each of the 5 codons as well. What is the complementary DNA sequence for the above DNA (the complementary sequence would be produced in DNA replication)? Suggested Format: DNA: TAC ATG TCT AGG ATC. Complementary: mRNA based on DNA: TRNAs that would pair with mRNA (the anticodon): Amino Acid Sequence: To transcribe the sequence...
Question Give an mRNA sequence that will code for synthesis of metenkephalin. Tyr-Gly-Gly-Phe-Met Select codons from the following table. If more than one codon is possible for a given amino acid, choose only one If there are fewer than 8 amino acids in the peptide, leave the corresponding codons blank. Enter your answer in ALL CAPS, ie, "ATG" not "atg" Third base (3" end) First base (5' end) Second baseUCAG Phe Phe Leu Leu SerSer Ser Ser U Leu Leu...
QUESTION 8 Using the altered mRNA and the genetic code, provide the sequence of amino acids in the peptide chain created. c A G UUU UẬC Phe UUA UAU Ty lucccys UAA Stop UGA Stop A UAG Stop UGG Trp UUG Leu CUU CUC Leu CUA CCA Pro CUG CACCI CCG) ACU ACC ACA ACG sucu suco DUCU BUCO AUU AUC File AUA AUG Met GCU GCC GAC ASP GCA GUG GCG) GAG GUGGAGI GGG) Click Save and Submit to...
What amino acid would the Manticodon code for RNA codon table 2nd position Tot position СТА Tyr Phe Phe > eu eu Oulaa Jooo 9999 stop stop eu eu eu Let 0 - puchbucobucusura BER < Val Val Asp Ala Asp Ala Glu Ala Glu Amino Acids Keu Pro Pro His Weu Leu Gin lle Pro Thr Thr Thr Thr Asn Asn lle Ser Ser Arg lle Met Lys Lys bucoucouco Arg > Asp Asp Val Val Val Val Ala...
Question 10 (15 points) Given the following sequence for a template strand of DNA 3 - ATACTTTGTCGAGACCCGCTTCTTGCAGACTGGG A. Provide the mRNA sequence following transcription (include polarity) B. Provide the amino acid sequence using either the one letter or three letter abbreviations. Include polarity (N-or C-terminus) and be careful to start in the correct place: C. What if the "C" underlined above was changed to a T. What is the new codon? How does that affect the amino acid sequence? What...
If the sequence of an mRNA molecule is: 5' AUG GGA UUU CGA 3' (a) Give the sequence of the template strand of DNA. (Please indicate where the 5' and 3" ends are located) (1.5 marks) (b) Give the sequence of the non-template strand of DNA. (Please indicate where the 5' and 3" ends are located) (1.5 marks) (c) Give the amino acid sequence. (1.5 marks) You will require the following genetic code to answer this question. Second letter с...
Most questions answered within 3 hours.
-
Suppose that XX is a random variable with mean 16 and standard
deviation 5 . Also...
asked 42 minutes ago -
Calculate the number density of argon gas at a temperature of
24C and a pressure of...
asked 3 hours ago -
Alternative
Classification
How to Estimate
Probabilities from Data? ( For continuous Attributes)
And How to generate...
asked 3 hours ago -
An explosion breaks a 20.0-kg object into three parts. The
object is initially moving at a...
asked 4 hours ago -
Calculate the approximate number of residues of Rubisco, which
is involved in carbon fixation in plants,...
asked 5 hours ago -
Other decisions about scientific claims can have a much broader
impact.ENERGYarrow-10x10.png, environment, health, security - all...
asked 6 hours ago -
I need to write a research paper and work cited about this
topic: The United States...
asked 7 hours ago -
Hello! I was wondering if I could have some help?
If the vapor pressure of carvone...
asked 7 hours ago -
An economist wants to estimate the mean per capita income (in
thousands of dollars) for a...
asked 7 hours ago -
What would be the input/output characteristic of a circuit
obtained by putting two of your 2's-complementers...
asked 7 hours ago -
In Drosophila, the transition from the syncytial blastoderm
stage to the cellular blastoderm stage is a...
asked 8 hours ago -
Project management question:
Name 3 different types of resources (hint: humans are one
type)
asked 8 hours ago