Would a Bam HI restriction Digest of your suspect DNA look the same as a Pst...
Would a Bam HI restriction Digest of your suspect DNA look the same as a Pst I digest of it. Why or Why not.
Homework Answers
Answer; The Bam HI and Pst i restriction digests will not look like the same as the two restriction enzymes have different sequence of restriction and recognition sites, therefore, will yield restriction fragments of different sizes.
Add Answer to:
Would a Bam HI restriction Digest of your suspect DNA look the
same as a Pst...
Which restriction enzyme is best for cloning in pUC8? Pst I Hind III Bam HI Eco...
Which restriction enzyme is best for cloning in pUC8? Pst I Hind III Bam HI Eco RI endonuclease
A linear fragment of DNA is cleaved with the individual restriction enzymes Pst and Smal, and...
A linear fragment of DNA is cleaved with the individual restriction enzymes Pst and Smal, and then with a combination of the two enzymes. The fragments obtained are: Pst! Sma! Pst and Smal 7 kb, 12 kb 2 kb, 8 kb, 9 kb 2 kb, 4 kb, 5 kb, 8 kb Draw a restriction map of the DNA fragment. (5 marks). Model of example restriction map to show you how to give your answer: Hind Ill kb 2 kb Eco...
If the target DNA (the 3.266 Kb E. coli genomic Bam HI fragment) has the same restriction sites on each end, there are t...
If the target DNA (the 3.266 Kb E. coli genomic Bam HI fragment)
has the same restriction sites on each end, there are two possible
orientations for the target DNA to insert into the plasmid. The
following restriction enzymes would cut the 3.266 kb Bam HI genomic
fragment containing the RecA gene once or twice or not at all. In
the tables below, list the expected DNA fragment sizes for the two
possible orientations. Round the DNA fragment sizes to...
RESTRICTION DIGEST ANALYSIS QUESTIONS(true or yes = A: false or no = b) 1. Larger DNA...
RESTRICTION DIGEST ANALYSIS QUESTIONS(true or yes = A: false or no = b) 1. Larger DNA fragments appear near the bottom of the gel. 2. Larger DNA fragments move more rapidly through the gel. D ONA that has many restriction sites for a certain endonuclease will be cut into more fragmets than DNA with fewer restriction sites. 4. Cutting DNA with many different endonucleases will result in more DNA fragments. 5. Restriction enzymes all recognize the same base sequence when...
You are using three restriction enzymes to digest a double-stranded DNA in which the sequence of...
You are using three restriction enzymes to digest a double-stranded DNA in which the sequence of the upper strand is 5'-TTGTCGATGCGAATTCGGTGATGGATCCTAGGTCGTGTAGCATGCATGCCGGATCCTAGCTGAGC'-3. The recognition sites of the enzymes are G'AATTC (EcoRI), G'GATCC (BamHI), and GCATG'C (SphI). The cleavage sites are indicated with '. Determine how long the DNA fragments will be after digesting the DNA with each of these enzymes individually. Additionally, determine the length of the fragments if you digest with both enzymes BamHI and SphI. In a drawing, show...
A linear fragment of DNA is cleaved with the individual restriction enzymes Hindill and Smal, and...
A linear fragment of DNA is cleaved with the individual restriction enzymes Hindill and Smal, and then with a combination of the two enzymes. The fragments obtained are: Eco RV 2 kb, 3.5 kb, 9.5 kb Bam HI 6 kb, 9 kb Eco RV and Bam H12 kb, 3.5 kb, 4 kb. 5.5 kb Draw a restriction map of the DNA fragment. (5 marks). Model of example restriction map to show you how to give your answer: Eco R1 Hind...
Why do restriction enzymes need to be kept on ice? What order should the DNA, enzyme,...
Why do restriction enzymes need to be kept on ice? What order should the DNA, enzyme, water and buffer be added to the microcentrifuge tube for a restriction digest? If lambda DNA is linear, how many times would the enzyme have to cut the DNA to generate five DNA fragments? Would a shorter DNA fragment move faster or slower through the agarose gel than a longer fragment? Why?
You want to digest the phage genomic DNA you just isolated with a restriction enzyme called...
You want to digest the phage genomic DNA you just isolated with a restriction enzyme called HaeIII. You find the enzyme and a 10X stock of HaeIII enzyme buffer in the freezer. How much buffer will you add if the total volume of your reaction is 50 microliters?
Restriction Mapping Below is a restriction map for the plasmid PGEN101 (total length - 20 kb)....
Restriction Mapping Below is a restriction map for the plasmid PGEN101 (total length - 20 kb). Using this map as a guide, give the number of restriction fragments along with their associated lengths that would result from digesting PGEN101 with the restriction enzymes EcoRI, BamHII, anda combination of EcoRI + BamHI. BamHI BamHI BamHI / PGEN101 (20 kb) Mb EcoRI Digest Performed Size Emments Obtained EcoRI........ BamHI.. EcoRI + BamHI.... Two freshmen college students, interested in becoming gene jocks, performed...
If your DNA was not cut to completion during the restriction analysis of your transformants, what...
If your DNA was not cut to completion during the restriction analysis of your transformants, what would you expect your gel to look like? Would you still be able to distinguish positive from negative clones?
A linear fragment of DNA is cleaved with the individual restriction enzymes Pst and Smal, and then with a combination of the two enzymes. The fragments obtained are: Pst! Sma! Pst and Smal 7 kb, 12 kb 2 kb, 8 kb, 9 kb 2 kb, 4 kb, 5 kb, 8 kb Draw a restriction map of the DNA fragment. (5 marks). Model of example restriction map to show you how to give your answer: Hind Ill kb 2 kb Eco...
If the target DNA (the 3.266 Kb E. coli genomic Bam HI fragment)
has the same restriction sites on each end, there are two possible
orientations for the target DNA to insert into the plasmid. The
following restriction enzymes would cut the 3.266 kb Bam HI genomic
fragment containing the RecA gene once or twice or not at all. In
the tables below, list the expected DNA fragment sizes for the two
possible orientations. Round the DNA fragment sizes to...
RESTRICTION DIGEST ANALYSIS QUESTIONS(true or yes = A: false or no = b) 1. Larger DNA fragments appear near the bottom of the gel. 2. Larger DNA fragments move more rapidly through the gel. D ONA that has many restriction sites for a certain endonuclease will be cut into more fragmets than DNA with fewer restriction sites. 4. Cutting DNA with many different endonucleases will result in more DNA fragments. 5. Restriction enzymes all recognize the same base sequence when...
A linear fragment of DNA is cleaved with the individual restriction enzymes Hindill and Smal, and then with a combination of the two enzymes. The fragments obtained are: Eco RV 2 kb, 3.5 kb, 9.5 kb Bam HI 6 kb, 9 kb Eco RV and Bam H12 kb, 3.5 kb, 4 kb. 5.5 kb Draw a restriction map of the DNA fragment. (5 marks). Model of example restriction map to show you how to give your answer: Eco R1 Hind...
Restriction Mapping Below is a restriction map for the plasmid PGEN101 (total length - 20 kb). Using this map as a guide, give the number of restriction fragments along with their associated lengths that would result from digesting PGEN101 with the restriction enzymes EcoRI, BamHII, anda combination of EcoRI + BamHI. BamHI BamHI BamHI / PGEN101 (20 kb) Mb EcoRI Digest Performed Size Emments Obtained EcoRI........ BamHI.. EcoRI + BamHI.... Two freshmen college students, interested in becoming gene jocks, performed...
Most questions answered within 3 hours.
-
Computer Programming II CS141(Java)
Mention the appropriate relationship between following
classes:
HOD–StaffMember
Car–Ferrari
Student-Address
BankAccount–FixedAccount
House-Building...
asked 2 hours ago -
Assume one of your finals has 50 questions on it, and
lucky for you, it's all...
asked 3 hours ago -
Rice Products in Bangladesh
Business behavior is derived in large part from the basic cultural
environment...
asked 4 hours ago -
The following base sequence is found for a mRNA fragment from
wild-type E. coli: 5'- UAUCAGUAGAUAAUGUAACC-3'...
asked 5 hours ago -
For this exercise, round all regression parameters to three
decimal places.
One of the two tables...
asked 5 hours ago -
What is the 5% level of significance for mean = 3.60, standard
deviation = 0.94, and...
asked 5 hours ago -
Prior to beginning work on this discussion, please read the
article by Hayley Peterson, 15 Companies...
asked 6 hours ago -
Which pair of aqueous solutions, when mixed, will form a
precipitate?
A) NaNO3 and AgC2H3O2
B)...
asked 6 hours ago -
1-Write an algorithm to get two numbers from the user (as
inputs) and calculate the sum...
asked 9 hours ago -
Define white-collar crime. What is the difference between
offender and offense-based definitions of white-collar crime? What...
asked 10 hours ago -
Consider a reaction which is 1st order with respect to A and 1st
order with respect...
asked 10 hours ago -
c++
The length of the hypotenuse of a right-angled triangle is the
square root of the...
asked 10 hours ago