You want to digest the phage genomic DNA you just isolated with a restriction enzyme called...

Question

Question

You want to digest the phage genomic DNA you just isolated with a restriction enzyme called...

You want to digest the phage genomic DNA you just isolated with a restriction enzyme called HaeIII. You find the enzyme and a 10X stock of HaeIII enzyme buffer in the freezer. How much buffer will you add if the total volume of your reaction is 50 microliters?

science biology

Add a comment Improve this question Transcribed image text

Answer 1

Answer #1

Answer: 5 microliters of the 10 X HaeIII enzyme buffer is need to be added in a 50 microliter total reaction volume, to get a final buffer concentration of 1 X as a working buffer concentration. HaeIII recognize GGCC and produce blunt ends,

Add a comment

Answer 2

Similar Homework Help Questions

Suppose you are going to do a restriction digest with a plasmid, using the restriction enzyme...

Suppose you are going to do a restriction digest with a plasmid, using the restriction enzyme Eco R1. A map of the plasmid is shown here. The entire plasmid is 6000 bp, and there are Eco R1 restriction sites at 1500 bp, 2000 bp, and 4000 bp. You’re going to run the entire volume of the digest on a gel, and you want to cut just enough DNA to have 50 ng in the smallest band on your gel. Starting...
Suppose you digest the genomic DNA of a particular organism with the restriction enzyme SauA. Then...

Suppose you digest the genomic DNA of a particular organism with the restriction enzyme SauA. Then you ligate the resulting fragment into a unique BamHI cloning site of a plasmid. The sequence of the restriction sites and position of cleavage is shown below Note: X and Y and their complementary bases Z and Y’ respectively can be any base (A,C, G, or T) 1) As you can see, ligation is possible because the two restriction enzymes produce compatible sticky ends....
You are preparing to clone a DNA fragment into a plasmid vector. You start by linearizing...

You are preparing to clone a DNA fragment into a plasmid vector. You start by linearizing your plasmid (concentration = 500 ng/μl) with EcoRI, which is provided in a standard 50% glycerol solution at 10 units/μl. Your enzyme also comes with an appropriate 10X reaction buffer. Taking into account the final allowable glycerol concentration, you want to add the maximum amount of EcoRI, to achieve complete digestion of 1 μg plasmid DNA in a total volume of 20 μl. Fill...

How are we getting the volumes in this solution for example for 10Xs buffer how did we get 1 microliter please explain for each reagent how the microliters were obtained; ddH20, 10X buffer A, 1 micro...

How are we getting the volumes in this solution for example for 10Xs buffer how did we get 1 microliter please explain for each reagent how the microliters were obtained; ddH20, 10X buffer A, 1 microgram/microliter DNA stock, and enzyme at 10 U/microliter. Question: What is the most concentrated stock of buffer A you can make? Now if you want to prepare an enzymatic reaction containing 1X buffer A, 100 ng/ul DNA stock and 1 Unit/ul (U/ul) of enzyme proceed...
How are we getting the volumes in this solution for example for 10Xs buffer how did...

How are we getting the volumes in this solution for example for 10Xs buffer how did we get 1 microliter please explain for each reagent how the microliters were obtained; ddH20, 10X buffer A, 1 microgram/microliter DNA stock, and enzyme at 10 U/microliter. Question: What is the most concentrated stock of buffer A you can make? Now if you want to prepare an enzymatic reaction containing 1X buffer A, 100 ng/ul DNA stock and 1 Unit/ul (U/ul) of enzyme proceed...
7. You purify DNA from a miniprep and wis units/ml (1 unit = 1 hg of...

7. You purify DNA from a miniprep and wis units/ml (1 unit = 1 hg of DNA digested per hour u to ensure complete digestion), 5X reaction butter, (b-e) to calculate how to prepare a restriction enzym a. Using the A260, what is the DNA's concentration? na miniprep and wish to digest it with EcoRI. You have DNA with an A260 of 2.0, EcoRI at digested per hour under optimal conditions, but 10 units are usually used per reaction "...

3. (2 pts.) You are sequencing the end of a genomic DNA fragment that was cut...

3. (2 pts.) You are sequencing the end of a genomic DNA fragment that was cut with the restriction enzyme BamH1 and ligated into a plasmid that was also cut with BamH1. You have denatured the DNA and annealed a labeled primer to plasmid sequences adjacent t<o the insertion site as shown below: 3' BamHi 5' GATCTAGCTAGCTAGCTAGCTAGCTAGCTAGCCATCGATGCTAGGAATCTTTGCTGATGCTAGTCGATGCCGTAGC ACTACGATCAGCTACGGC 3' 18 base primer 5' Next you add DNA polymerase, buffer, an excess of all four dNTPs, and a small amount of...
If you were setting up a 20μl restriction digest, how much of the 5X buffer would...

If you were setting up a 20μl restriction digest, how much of the 5X buffer would you use? a. 2.0 μl b. 4.0 μl c. 16 μl d. 5 times the volume of restriction endonuclease used.
Question 6 Using stock solutions to make up a solution: from final concentration to volume You...

Question 6 Using stock solutions to make up a solution: from final concentration to volume You need to digest a sample of DNA with a restriction enzyme. You will do this reaction later in the semester. The buffer for this reaction has a final concentration of 40 mM Tris, pH 7.5, 10 mM MgCl2 and 50 mM KCl. You have the following stock solutions: 0.5 M Tris, pH 7.5, 1 M MgCl2 and 2 M KCl. How would you make...

1. An enzyme used to covalently join DNA segments to form recombinant DNA molecules is called...

1. An enzyme used to covalently join DNA segments to form recombinant DNA molecules is called a A. Restriction endonuclease B. Reverse transcriptase C. DNA polymerase D. Helicase E. Ligase 7. The procedure for introducing changes into specific genes is called A. An enhancer trap B. Imprinting C. RT-PCR D. DNA looping E. Gene targeting 2. Plasmids used for in vitro cloning of foreign DNA fragments are called A. Donors B. DNA chips C. Clones D. Vectors E. Conjugants 8....

You want to digest the phage genomic DNA you just isolated with a restriction enzyme called...

Homework Answers

Add Answer to:
You want to digest the phage genomic DNA you just isolated with a restriction enzyme called...

Post as a guest

Earn Coins

Suppose you are going to do a restriction digest with a plasmid, using the restriction enzyme...

Suppose you digest the genomic DNA of a particular organism with the restriction enzyme SauA. Then...

You are preparing to clone a DNA fragment into a plasmid vector. You start by linearizing...

How are we getting the volumes in this solution for example for 10Xs buffer how did we get 1 microliter please explain for each reagent how the microliters were obtained; ddH20, 10X buffer A, 1 micro...

How are we getting the volumes in this solution for example for 10Xs buffer how did...

7. You purify DNA from a miniprep and wis units/ml (1 unit = 1 hg of...

3. (2 pts.) You are sequencing the end of a genomic DNA fragment that was cut...

If you were setting up a 20μl restriction digest, how much of the 5X buffer would...

Question 6 Using stock solutions to make up a solution: from final concentration to volume You...

1. An enzyme used to covalently join DNA segments to form recombinant DNA molecules is called...

You want to digest the phage genomic DNA you just isolated with a restriction enzyme called...

Homework Answers

Add Answer to: You want to digest the phage genomic DNA you just isolated with a restriction enzyme called...

Post as a guest

Earn Coins

Add Answer to:
You want to digest the phage genomic DNA you just isolated with a restriction enzyme called...