What is the rate-limiting step in the processes of DNA replication and DNA transcription?
Please find the answers below:
1. Rate limiting step in DNA replication: During DNA replication, the DNA polymerase binds to the template strand of the double helix by appropriate identification of the template and non-template strand. This step is the rate limiting step of DNA replication initiation and the whole process and holds true for both leading and lagging strands. Failure of binding of the DNA polymerase to template strand or faulty binding can both lead to drastic down-regulation in the processivity of DNA replication.
2. Rate limiting step in trasncription: There are many rate limiting steps in the process of transcription. Out of all, the binding of RNA polymerase to template DNA remains one of the most critical and rate limiting event. Further, during elongation of transcription, the phosphorylation of C-terminal domain of the transcription elongation factor II remains the rate limiting step which can immediately halt the whole process if remains un-phosphorylated at the serine residues.
Thus, rate limiting steps in these biological process are highly critical for determination of fidelity and processivity.
What is the rate-limiting step in the processes of DNA replication and DNA transcription?
What DNA/RNA/protein(s) is/are involved in the following processes in... DNA Replication Transcription - Prokaryotes Transcription - Eukaryotes What serves as the template? Unwinding of DNA Initiation Elongation What direction does elongation occur? Termination What is the end product of this process? How many strands? Processing after?
Identify the components of replication, transcription, and translation processes. Replication transcription translation DNA polymerase, deoxynucleoside triphosphate, primer, RNA polymerase, nucleoside triphosphate, transfer RNA, ribosome, messenger RNA , promoter, ribosomal RNA
Indicate which cellular processes directly require DNA replication (R), transcription (TC), or translation (TL). 'Directly' means the cellular process that must occur immediately before the one in the question. synthesis and secretion of insulin from the liver meiosis of spermatogonia production of LH mRNA in the pituitary gland mitosis of intestinal epithelial cells synthesis of steroid hormone receptors
How are transcription and the replication of novel coronavirus related? See what you can find out about the genome of the virus and relate it to the processes we have discussed: replication of DNA, and transcription into RNA. The virus has a biology quite different from ours where we pass on genetic information by copying DNA (S phase), and dividing it (mitosis or meiosis). Since viruses make use of the hosts machinery, this difference makes their reproduction more tricky. As...
Genetics Question How are transcription and the replication of novel coronavirus related? See what you can find out about the genome of the virus and relate it to the processes we have discussed: replication of DNA, and transcription into RNA. The virus has a biology quite different from ours where we pass on genetic information by copying DNA (S phase), and dividing it (mitosis or meiosis). Since viruses make use of the hosts machinery, this difference makes their reproduction more...
3. Compare the key players in DNA replication, transcription, and translation by filling out a table such as this one (this is just a template, you will need more space than what’s provided here). Key players Replication Transcription Translation DNA components RNA components Protein components
1.What is a consensus sequence, and how is this used to initiate the processes of DNA replication, transcription and translation? 2.Outline several mechanisms by which DNA or RNA (especially mRNA) can be protected from degradation and have “extended life”.
The following questions pertain to DNA replication, transcription, and translation. Below is part of a DNA sequence: TACCAAGGAGCATTAGATACT a.) What is the complementary DNA sequence that would be made if the sequence shown above were used as the template strand during DNA replication? (1 pt) b.) What is the mRNA that would be made from the DNA sequence shown (the sequence given NOT your answer to part a) if it were used as the template strand during transcription? (1 pt)...
BI U A. A. EEE 1. What is replication? 2. What is Transcription? 3. What are the differences between replication and transcription? 4. What is translation? 5. What is the role of mRNA, TRNA, and tRNA during translation? 6. What is the function of ribosomes? 7. Which enzyme catalyzes the transcription? 8. A DNA molecule has two strands (double helix) - how many of its strands are/is replication and transcription? 9. What is the difference between transcription and translation occurring...
Replication, Transcription, and Translation >> Use the provided DNA sequence to generate an amino acid sequence > Replication: use base pairing rules (A-T, C-G) to create a new strand of DNA Transcription: use the new strand of DNA to make a strand of RNA; don't forget that RNA uses U instead of T > Translation: use the genetic code to determine the amino acid sequence w BEUTE ZERBS 21 Second letter WAU) Tyr Urddon Stop UGI UAG Stop UGG Osclone...