2.1) This theory is called as the 'central dogma'.
2.2)
Second DNA strand: CGC CGA ATG ATT (as per rules of Watson Crick base pairing)
mRNA: GCG GCU UAC UAA (as per rules of complimentarity, T is replaced with U in mRNA)
A: Coding strand (has same sequence as mRNA)
B: Non-coding strand (the template strand for mRNA)
C: 5'
D: 3'
E: 3'
F: 5'
2.3)
Protein: Ala Ala Tyr (stop)
If you find this answer helpful, kindly give it a thumbs up!
2. Study the table below that summarises the flow of genetic information in a cell, and...
mRNA transcr leaves the mucl ke protcins Th eings the amino no acids anre the bui ead in onder to. start and stop mak Land when to stot C. Use your codon chart to determine the amino acid sequence. Remember to read through the strand and ONLY start on AUG and STOP when it tells you to stop Follow example below Example: DNA AGA CGG TAC CTC CGG TGG GTG CTT GTC TGT ATC CTT CTC AGT ATC UCU GCC...
Below are several DNA sequences that are mutated compared with the wild-type sequence: 3-TAC TGACTGACGAT C-5. Envision that each is a section of a DNA molecule that has separated in preparation for transcription, so you are only seeing the template strand. Construct the complementary DNA sequences (indicating 5' and 3' ends) for each mutated DNA sequence, then transcribe (indicating 5' and 3' ends) the template strands, and translate the mRNA molecules using the genetic code, recording the resulting amino acid...
Question 3 (4 pts): The following table provides just enough information about a section of a particular gene to allow you to determine: (a) the sequence of the base pairs along the DNA, (b) which DNA strand serves as the template for mRNA transcription, (c) the mRNA nucleotide sequence, (d) the tRNA anticodons, and (c) the amino acid sequence of the polypeptide. Complete the table and make sure you indicate which DNA strand is the template for mRNA transcription and...
Lecture Homework Assignment (LHA) #3 BIO 2010 Microbiology Print Name: Section # Sequences of single strands of DNA are shown below for two different pieces of DNA. Assume that the DNA sequences are not at the beginning of a gene and that the spaces between each DNA triplet represent the correct reading frame, Label all sequences 5 and 3', where appropriate. Keep everything aligned properly. A Synthesize the complementary DNA sequence. B. Transcribe the mRNA sequence starting with the 5...
5. Using arrows, write the flow of genetic information in correct sequence for the following three components: mRNA, protein (amino acid sequence), DNA 14-121 PEA
Fill in the complementary base pairs for the strand below STACGCCCATTI TAGA ATTGCGTGGGCATTAAGTTTTA TACC3 DNA sequences 3' I Find and put a square around the TATA box (promoter) in the double stranded DNA above Find and circle the terminator sequence (GGGCG) in one of the strands above The strand with promoter and terminator is the strand of interest: using the template strand, synthesize an mRNA sequence mRNA molecule in the boxes below; pay attention to polarity 53: Find and circle...
Microbiology: DNA-mRNA-tRNA translation . HELP ASAP of DNA are shown below for two different pieces of DNA ces are not at the beginning of a gene and that the spaces Assume that thn me that the seq between ea 3 , where appropriate. Keep everything aligned properly. A. Synthesize the complementary DNA sequence ch DNA triplet represent the correct reading frame. Label all sequences 5' and e mRNA sequence starting with the 5 end on the left-hand side. C. Write...
2. A (1 pt) Using the Genetic Code table, determine the peptide that is encoded by the part of the mRNA molecule shown. Use the three-letter designation for amino acids. Start with the first start codon the ribosome would translate, and end at a stop codon 5'-CUGCGAUGAUUAGCCUAAUGGUUGAGAGUUGAUAGGCG-3 B. (0.25 pt) If this is a eukaryotic mRNA, would the TATA box present in the full-length transcript?
2. For the following short segment of a DNA strand, complete the following table. The codon dictionary is provided for you on the previous page. Translation and the Genetic Code: mRNA Codons 1. Define the following terms and whether they exist in DNA or RNA. Term DNA or RNA? Gene Definition Codon 2. For the following short segment of a DNA strand, complete the following table. The codon dictionary is provided for you on the previous page Coding DNA sequence:...