Homework Answers
Add Answer to:
Part D Gel Electrophoresis and DNA All of the DNA fragments will be in charge, migrate...
Put these DNA fragments in order of their position after gel electrophoresis, starting with the one...
Put these DNA fragments in order of their position after gel electrophoresis, starting with the one closest to the negative end of the gel and ending with the one closest to the positive end of the gel. 73 bp 42 bp 100 bp 25 bp
NA fingerprinting uses a process called gel electrophoresis to separate the fragments of DNA. Once the...
NA fingerprinting uses a process called gel electrophoresis to separate the fragments of DNA. Once the DNA fragments are sorted, the pattern of bands can be analyzed. 1)Gel Electrophoresis Procedure The smaller DNA fragments start to move away from the wells and the larger DNA fragments remain closer to the wells. 2)An electric current is passed through the gel. 3) DNA fragments are treated with a dye. 4)A restriction endonuclease is added to the DNA. 5)Using micropipettes, the DNA samples...
Gel electrophoresis separates DNA fragments according to the sequence of their bases. their length. the number...
Gel electrophoresis separates DNA fragments according to the sequence of their bases. their length. the number of mutations they carry. differences in electrical charge.
During gel electrophoresis, DNA travels towards the positive charge. Including the substance agarose in the gel...
During gel electrophoresis, DNA travels towards the positive charge. Including the substance agarose in the gel allows for visualization of DNA under UV light. Below is an image of a gel run with a single DNA sample (ane 2) and a DNA ladder (lane 1). Using the DNA ladder reference included to the right, it can be concluded that two fragments labeled C&D in the DNA sample are approximately 6.0 Lane 1 2 kilobases and 3.0 kilobsases, respectively. Laai Auxilwa...
In the nuclease digestion experiment, the scientists use a technique called gel electrophoresis. While this is...
In the nuclease digestion experiment, the scientists use a technique called gel electrophoresis. While this is related to SDS-PAGE used in the separation of membrane proteins, it is NOT THE SAME thing. From the list below, choose all the ways that gel electrophoresis is done for nuclease digestion is different from the gel electrophoresis in SDS-PAGE. Group of answer choices 1.Used to separate DNA or RNA. 2.Used to separate proteins. 3.Prteins and DNA must be separated prior to running the...
Biologists use gel electrophoresis to sort DNA segments by size. DNA segments are placed at one...
Biologists use gel electrophoresis to sort DNA segments by size. DNA segments are placed at one end of a gel. DNA is negatively charged (with a charge of two electrons per base pair). When you “run the gel” you are generating an electric field by connecting anodes and cathodes at the ends of the gel. This causes the negatively charged DNA segments to move towards the positive electrode. After running the gel, smaller DNA segments have moved farther from the...
The picture above represents an agarose gel that was used to analyze plasmid DNA after it...
The picture above represents an agarose gel that was used to analyze plasmid DNA after it was cut with the restriction enzyme HindIll. The plasmid was incubated with Hindill until all of the available Hindlll cut sites were cut by HindIll. After running the sample on the gel, three bands were detected (Note that there are three wells shown at the top of the gel for loading samples, however, only the middle well was loaded with sample). Based on this...
Question 4-12 points Biologists use gel electrophoresis to sont DNA segments by size. DNA segments are...
Question 4-12 points Biologists use gel electrophoresis to sont DNA segments by size. DNA segments are placed at one end of a gel. DNA is negatively chargod (with a charge of two electrons per base pair). When you "run the gel" you are generating an electric field by connecting anodes and cathodes at the ends of the gel This causes the negatively charged DNA segments to move towards the positive electrode. After nunning the gel, smaller DNA segments have moved...
One strand of a DNA sequences is given below. Find the EcoRI sites and indicate the...
One strand of a DNA sequences is given below. Find the
EcoRI sites and indicate the cutting site with an arrow. Count the
number of bases in each fragment.
CP22: vne strand of a DNA sequence is given below. Find the EcoRI sites and indicate the cutting site with an arrow. Count the number of bases in each fragment. Restriction digest A: ATTGAATTCCGGTTAGCTTTAGAATTCCGCCATATGCGCAATTGGAATTCC Number of bases in each fragment: Now compare the same region of DNA from another individual. Where...
Part B and D Please show all of the steps. Learning Goal: To relate current, time,...
Part B and D
Please show all of the steps.
Learning Goal: To relate current, time, charge, and mass for electroplating calculations. Electroplating is a form of electrolysis in which a metal is deposited on the surface of another metal. To quantify electrolysis, use the following relationships. Electric current is measured in amperes (A), which expresses the amount of charge, in coulombs (C), that flows per second (s): 1 A 1 C/s Another unit of charge is the faraday (F),...
During gel electrophoresis, DNA travels towards the positive charge. Including the substance agarose in the gel allows for visualization of DNA under UV light. Below is an image of a gel run with a single DNA sample (ane 2) and a DNA ladder (lane 1). Using the DNA ladder reference included to the right, it can be concluded that two fragments labeled C&D in the DNA sample are approximately 6.0 Lane 1 2 kilobases and 3.0 kilobsases, respectively. Laai Auxilwa...
The picture above represents an agarose gel that was used to analyze plasmid DNA after it was cut with the restriction enzyme HindIll. The plasmid was incubated with Hindill until all of the available Hindlll cut sites were cut by HindIll. After running the sample on the gel, three bands were detected (Note that there are three wells shown at the top of the gel for loading samples, however, only the middle well was loaded with sample). Based on this...
Question 4-12 points Biologists use gel electrophoresis to sont DNA segments by size. DNA segments are placed at one end of a gel. DNA is negatively chargod (with a charge of two electrons per base pair). When you "run the gel" you are generating an electric field by connecting anodes and cathodes at the ends of the gel This causes the negatively charged DNA segments to move towards the positive electrode. After nunning the gel, smaller DNA segments have moved...
One strand of a DNA sequences is given below. Find the
EcoRI sites and indicate the cutting site with an arrow. Count the
number of bases in each fragment.
CP22: vne strand of a DNA sequence is given below. Find the EcoRI sites and indicate the cutting site with an arrow. Count the number of bases in each fragment. Restriction digest A: ATTGAATTCCGGTTAGCTTTAGAATTCCGCCATATGCGCAATTGGAATTCC Number of bases in each fragment: Now compare the same region of DNA from another individual. Where...
Part B and D
Please show all of the steps.
Learning Goal: To relate current, time, charge, and mass for electroplating calculations. Electroplating is a form of electrolysis in which a metal is deposited on the surface of another metal. To quantify electrolysis, use the following relationships. Electric current is measured in amperes (A), which expresses the amount of charge, in coulombs (C), that flows per second (s): 1 A 1 C/s Another unit of charge is the faraday (F),...
Most questions answered within 3 hours.
-
The denaturation of proteins can be described by the
equilibrium
F⇌U
where F and U represent...
asked 22 minutes ago -
Please answer what the maximum and minimum force is, and the
angle on the ion is...
asked 24 minutes ago -
implement a program that reads a number of rows and a symbol.
The program will draw...
asked 30 minutes ago -
Assume that when adults with smartphones are randomly selected,
45% use them in meetings or classes....
asked 34 minutes ago -
Determine the number of formula units of
Na2SO4 and moles of oxygen contained in 8.11
moles...
asked 43 minutes ago -
Explain in steps on the following code
What would be the output when executed
using System;...
asked 51 minutes ago -
Given the information in the table, which of the following
statements is CORRECT?
Stock A
Stock...
asked 49 minutes ago -
Write MARIE assembly language programs that do the following:
Write a program that inputs an integer...
asked 53 minutes ago -
Explain an understanding of services and protocols.
Explain the job of DNS.
Explain the three email...
asked 1 hour ago -
(As soon as possible) Balance each of the following equations
according to the half-reaction method:
H2O2(aq)...
asked 1 hour ago -
A thin rod with a mass of 3.5kg and a length L=1.5 m is oriented
horizontally....
asked 1 hour ago -
Inheritance pattern in BRCA 1
Describe the inheritance pattern of BRCA 1 Is it recessive or...
asked 1 hour ago