Put these DNA fragments in order of their position after gel electrophoresis, starting with the one closest to the negative end of the gel and ending with the one closest to the positive end of the gel.
73 bp
42 bp
100 bp
25 bp
Put these DNA fragments in order of their position after gel electrophoresis, starting with the one...
Part D Gel Electrophoresis and DNA All of the DNA fragments will be in charge, migrate toward the differences in and separate from one another due t Choose one answer from below. negative; cathode; size negative; anode; charge negative; anode; size positive; cathode; size positive; cathode; charge Submit Request Answer Incorrect; One attempt remaining; Try Again
NA fingerprinting uses a process called gel electrophoresis to separate the fragments of DNA. Once the DNA fragments are sorted, the pattern of bands can be analyzed. 1)Gel Electrophoresis Procedure The smaller DNA fragments start to move away from the wells and the larger DNA fragments remain closer to the wells. 2)An electric current is passed through the gel. 3) DNA fragments are treated with a dye. 4)A restriction endonuclease is added to the DNA. 5)Using micropipettes, the DNA samples...
2. Here are some DNA fragments that have been isolated by gel electrophoresis after being cut with restriction enzynes. A. 5 '-ACTGACATAGGCACCCCTTAA-3 3'-TGACTGTATCCGTGGGG-5 5 '-TGACTGTATCCGTGGGG-3' 3 '-ACTGACATAGGCACCCCTTAA-5' 5 '-GGCATACTAGATCCACGTTAA-3 3'-CCGTATGATCTAGGTGC-5 5 '-GGCATACTAGATCCACGAATT-3 3'-CCGTATGATCTAGGTGC-5 E. 5 '-GGCATACTAGATCCACGGATC-3 3'-CCGTATGATCTAGGTGC-5 a. Which pair of these fragments has appropriate complementary sticky ends to get joined together in a recombinant DNA molecule? b. What enzyme would we use to join up the DNA backbones to make the make the recombinant molecule?
Biologists use gel electrophoresis to sort DNA segments by size. DNA segments are placed at one end of a gel. DNA is negatively charged (with a charge of two electrons per base pair). When you “run the gel” you are generating an electric field by connecting anodes and cathodes at the ends of the gel. This causes the negatively charged DNA segments to move towards the positive electrode. After running the gel, smaller DNA segments have moved farther from the...
What would happen to DNA if the gel tray within an electrophoresis chamber were placed incorrectly, with the wells closest to the positive electrode? Choose one: A. DNA would remain in the gel. B. DNA bands would appear smeared. C. DNA would be pulled through the gel in the wrong direction. D. DNA would not fluoresce under UV light.
Can someone help me with this homework question on gel
electrophoresis?
Translocation and deletion 3. You PCR amplify a 500 bp (base pairs) piece of DNA that has diagnostic value in determining whether a patient has a mutation within a specific DNA region. You know that this DNA segment of the "normal" gene does not include an EcoRI restriction site; but the mutated DNA segment of the same gene contains an EcoRI restriction site due to a point mutation at...
Question 4-12 points Biologists use gel electrophoresis to sont DNA segments by size. DNA segments are placed at one end of a gel. DNA is negatively chargod (with a charge of two electrons per base pair). When you "run the gel" you are generating an electric field by connecting anodes and cathodes at the ends of the gel This causes the negatively charged DNA segments to move towards the positive electrode. After nunning the gel, smaller DNA segments have moved...
One strand of a DNA sequences is given below. Find the
EcoRI sites and indicate the cutting site with an arrow. Count the
number of bases in each fragment.
CP22: vne strand of a DNA sequence is given below. Find the EcoRI sites and indicate the cutting site with an arrow. Count the number of bases in each fragment. Restriction digest A: ATTGAATTCCGGTTAGCTTTAGAATTCCGCCATATGCGCAATTGGAATTCC Number of bases in each fragment: Now compare the same region of DNA from another individual. Where...
10. You electrophorese a DNA sample containing two linear fragments of DNA, one large and one small. Which one do you expect to find closest to the negative electrode? 11. Why do you not increase the voltage during electrophoresis? It would speed up the process considerably. What if you mistakenly used distilled water instead of TAE buffer for your electrophoresis? Would there be any difference in the outcome? 12. 13. What does ethidium bromide do?
The picture above represents an agarose gel that was used to analyze plasmid DNA after it was cut with the restriction enzyme HindIll. The plasmid was incubated with Hindill until all of the available Hindlll cut sites were cut by HindIll. After running the sample on the gel, three bands were detected (Note that there are three wells shown at the top of the gel for loading samples, however, only the middle well was loaded with sample). Based on this...